Skip to main content

A new profiling approach for DNA sequences based on the nucleotides' physicochemical features for accurate analysis of SARS-COV-2 genomes

Open In Colab

PC-mer Workflow

PC-mer(workflow)

INTRODUCTION

The classification of different organisms into subtypes is one of the most important tools of organism studies, and among them, the classification of viruses itself has been the focus of many studies due to their use in virology and epidemiology. Many methods have been proposed to classify viruses, some of which are designed for a specific family of organisms and some of which are more general. But still, especially for certain categories such as Influenza and HIV, classification is facing performance challenges as well as processing and memory bottlenecks. In this way, we designed an automated classifier, called PC-mer, that is based on k-mer and physicochemical characteristics of nucleotides, which reduces the number of features about 2 k times compared to the alternative methods based on k-mer, and compared to integer and one-hot encoding methods, it is possible to keep the number of features constant despite the growth of the sequence length. In this way, it also increases the training speed by an average of 88%. This improvement in processing complexity is provided while PC-mer can also improve the classifying performance for a variety of virus families.

PC-mer's Performance

Classification Accuracy:

Datasets Accuracy
(%)
F1
(%)
Precision
(%)
Recall
(%)
Test-1 97.25 97.23 97.38 97.25
Test-2 95.93 95.9 96.16 95.93
Test-3a 98.52 98.49 98.85 98.52
Test-3b 100 100 100 100
Test-4 100 100 100 100
Test-5 99.33 99.36 99.55 99.33
Test-6 100 100 100 100
Human Coronavirus 100 100 100 100

Test Accuracy (Covid-19 Dataset)

Datasets Testing datasets Prediction Accuracy (%) Predicted label
Test-1 29 Covid-19 Virus sequences 100 Riboviria
Test-2 29 Covid-19 Virus sequences 100 Coronaviridae
Test-3(a/b) 29 Covid-19 Virus sequences 100 Betacoronavirus

Time Performace:

As another advantage of our proposed encoding method, PC-mer can significantly improve the total processing time, which includes the runtimes of preprocessing, training, and testing procedures. Thanks to its powerful encoding algorithm and thus, facilitating usage of simple machine learning-based models to classify Coronaviridae family, all classification experiments, including preprocessing, training, and testing steps, have been performed on a desktop computer and a CPU processor.

Time2(5)

Memory Consumption:

It is worth mentioning that PC-mer encoding allows usage of larger k-mers by reducing the size of encoded data. Specifically, PC-mer encoding is designed to reduce the computational overhead of k-mers, as well as the volume of the generated data from O(4^k) to O(3×2^k). For example, assuming k=7 in the FCGR method, a vector of size 16,384 is generated for each genome sequence, while PC-mer encoding generates a vector of size 12,288 for each genomic sequence, assuming k=12, which is much smaller than that of the FCGR’s generated data for k=7. It should be mentioned that assuming k-mers of size 12 in the FCGR method leads to a vector of size 16,777,216 per genome sequence. As a key superiority, PC-mer encoding with k = 7 (that produces vectors of size 384 for each genome sequence) achieves equal or higher accuracy, compared to the MLDSP tool with k-mers of size 12. We can conclude that the data compression achieved by the PC-mer encoding not only increases the classification accuracy and the feasibility of using larger k-mers, but also it leads to significant reduction in preprocessing, training, and testing times.

Memory Consumption (PC-mer VS. FCGR) Classification Accuracy for the variation of k-mer size in the range of [1,12]
data-generated-nv(4) acc

PREREQUISITES

The method was implemented in Python 3.8 with the use of scikit-learn library running on a normal desktop computer (CPU: i7-6500 2.5 GHz, RAM: 8 GB RAM, HD: 256GB Lexar, GPU: GeForce GTX 920M.

PC-mer Package

Main Features

Let's Take a Rapid Tour of PC-mer Functions:

  • Change_DNA(dna): This function takes the contents of a fasta file and extracts the nucleotides. Also, all nucleotides are replaced by capital letters.
#Example
>>> dna=">MN908947.3 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome\nATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA"
>>> Change_DNA(dna)
#Output:
'ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA'
  • PC_mer(dna, k): k-mers generation function based on physicochemical properties. This function takes a sequence and size k as input and its output is the desired feature vector.
#Example
>>> PC_mer(Seq,2)
#Output:
array([16, 14, 13, 27, 16, 15, 15, 24, 27, 18, 17,  8])
  • GFL(path,k): Takes a path and automatically reads all the fasta files in the desired path and returns the generated feature vectors and their labels.
#Example
>>> GFL('data',2)
#Output:
([array([ 7327,  7490,  7489,  7597,  8887,  6570,  6570,  7876, 10780,
        7768,  7767,  3588]), array([ 7315,  7490,  7489,  7597,  8887,  6570,  6570,  7864, 10768,
        7768,  7767,  3588]), array([ 7291,  7469,  7468,  7574,  8861,  6627,  6627,  7687, 10391,
        7817,  7816,  3778]), array([ 7257,  7453,  7452,  7570,  8793,  6638,  6638,  7663, 10390,
        7799,  7798,  3745])], [0, 0, 1, 1])
  • train(PCmer_features, label, folds, clf): To evaluate the impact of encoding unit, we use six popular and practical supervised-learning based classification models (i.e. Logistic Regression (LR), Gaussian naïve Bayes (GNB), linear discriminant analysis (LDA), multi-layer perceptron (MLP), decision tree (DT), Linear Support Vector Classification (SVC)). So, Train function is designed to classify encoded genomic sequences (PCmer_features) automatically. This function takes PCmer_features, Ground truth labels, the number of cross-validation operations (folds) and classification algorithm (clf). Classification accuracy metrics and run time are the outputs of train function.
#Example
>>> train(PCmer_features, label, 10,clf='LR')
#Output:
time = 0.09
accuracy = 1.000
precision = 1.000 
recall = 1.000 
f1 = 1.000
  • get_metrics(Groundtruth, Predicted): Calculation of accuracy metrics (F1, accuracy, recall, precision) based on Ground truth and predicted labels.
#Example
>>> actual = [1, 3, 3, 2, 5, 5, 3, 2, 1, 4, 3, 2, 1, 1, 2]
>>> predicted = [1, 2, 3, 4, 2, 3, 3, 2, 1, 2, 3, 1, 5, 1, 1]
>>> get_metrics(actual,predicted)
#Output:
(0.4266666666666667, 0.4666666666666667, 0.4444444444444444, 0.4666666666666667)
  • comp_confmat(Groundtruth, Predicted): Create a confusion matrix based on Ground truth and predicted labels.
#Example
>>> actual = [1, 3, 3, 2, 5, 5, 3, 2, 1, 4, 3, 2, 1, 1, 2]
>>> predicted = [1, 2, 3, 4, 2, 3, 3, 2, 1, 2, 3, 1, 5, 1, 1]
>>> comp_confmat(actual,predicted)
#Output:
array([[3., 0., 0., 0., 1.],
       [2., 1., 0., 1., 0.],
       [0., 1., 3., 0., 0.],
       [0., 1., 0., 0., 0.],
       [0., 1., 1., 0., 0.]])
  • plot_confusion_matrix(cm, target_names, title='Confusion matrix', cmap=None, normalize=True): This function displays the Confusion Matrix based on comp_confmat function. The inputs of this function are cm (output of comp_confmat function) and target_names.
#Example
>>> plot_confusion_matrix(cm=CM,
                      normalize    = False,
                      target_names = ['2019-nCoV','Sarbecovirus'],
                      title        = "Test-6")
  • pcmer_api(fname,seqid): PCmer_api function downloads sequences from NCBI for training and testing PC-mer pipeline automatically. The inputs of this function are fname (your desired name for downloaded sample) and seqid.
#Example
>>> pcmer_api('sample-1','MG772933.1')

#Outputs:
Saved
Parsing...
ID: MG772933.1
Name: MG772933.1
Description: MG772933.1 Bat SARS-like coronavirus isolate bat-SL-CoVZC45, complete genome
Number of features: 0
Seq('ATATTAGGTTTTTACCTTCCCAGGTAACAAACCAACTAACTCTCGATCTCTTGT...AAA')

Now, generate your own pc-mer😉.

Quick Access Instructions

  1. Install:
!pip install physicochemical-mers==1.0.0
  1. Generate pcmer vectors:
from pcmer import features
#sample code
Seq = features.Change_DNA('id\nAGGAAAAGCCAACCAACCTCGATCTCTTGTAcct')
features = features.PC_mer(Seq, 2)

* A simple implementation *

Open In Colab

Method's Limitations

  • Length of Sequences: As mentioned, PC-mer is based on k-mer and physicochemical characteristics of nucleotides, which reduces the number of features about $2^k$ times compared to the alternative methods based on k-mer, and compared to integer and one-hot encoding methods, Also, PC-mer, similar to other k-mer-based methods, has the ability to convert sequences of any length into a fixed-length matrix. In this way, compared to methods such as integer and one-hot encoding, the number of extracted features remains constant. For more detailed comparison, the numbers of extracted features by the four methods (i.e. PC-mer (k = 11), k-mer (k = 11), Integer, and one-hot) are shown in below Figure for various sequence lengths. Although PC-mer can convert sequences of any length into a fixed-length matrix, its generalizability to achieve the acceptable accuracy for long sequences like humans is still a question. We achieved remarkable accuracy for the Coronavirus family with a maximum sequence length of 50000, but it is an open problem for datasets with different abundance, number of categories, sequence length and taxonomic levels. Therefore, we would examine and deeply investigate the PC-mer for other datasets, as a stand-alone study, as our future work. see here for other viral genome classification based on PC-mer.
ءثئخقغ

  • Acceptable Sequences: Most of the studies classifying whole-genome sequences either focus on noise-free data, or assume noise elimination as the preprocessing step. As a key capability of PC-mer, we also admit whole genome sequences containing probable noises (nucleotides that cannot be determined definitively during sequencing), and remove these noises. Of course, there are other mechanisms, such as aligning the input sequences with their genome reference and making decisions about these letters according to the reference genome, which, of course, may not be definitive and depend on the amount of noises. In other words, these methods assume known input sequences, which is not necessarily the case in real problems. In other words, the input sequence may not be known, and so, consumers try to identify it with clustering and classification tools, so considering genome reference for aligning with it might be impossible. On the other hand, in the problems dealing with the whole-genome sequence, the ratio of noise to the length of the sequence is not so high to necessitate input alignment, while for those problems dealing with reads, such as metagenomics problems, the alignment solution is adopted. Of course, in the continuation of our studies on the PC-mer method and other data, we would also use reads, such as metagenomics problems, and so, in future works,

CONTACT INFO

Somayyeh Koohi
Department of Computer Engineering
Sharif University of Technology
E-mail: koohi@sharfi.edu
Home page: http://sharif.ir/~koohi/

Release files for physicochemical-mers 1.0.0

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for physicochemical-mers 1.0.0
File Size Uploaded
physicochemical-mers-1.0.0.tar.gz 15.0 kB Details

Built distribution (wheel)

Table of built distributions (wheels) for physicochemical-mers 1.0.0
File Interpreter ABI Platform
physicochemical_mers-1.0.0-py3-none-any.whl Python 3 none any Details

Total release size:25.4 kB

Release files / physicochemical-mers-1.0.0.tar.gz

Download URL physicochemical-mers-1.0.0.tar.gz
Size 15.0 kB
Tags Source
SHA-256 checksum
How to use checksums
d5d7609258191a8319d2d5ac093dabac50d20986ae51426cb45e9790dce347f1
BLAKE2b-256 checksum
How to use checksums
ea8465d2acba680ec141a6da82f3b8536194ed2149e01f685a52216929d55643
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/4.0.2 CPython/3.9.1

Release files / physicochemical_mers-1.0.0-py3-none-any.whl

Download URL physicochemical_mers-1.0.0-py3-none-any.whl
Size 10.5 kB
Tags Python 3
SHA-256 checksum
How to use checksums
a8714a873e9936cc025a46ea295c287208c92969a2974cdec602492519ffe317
BLAKE2b-256 checksum
How to use checksums
22c4f0427b0638eeba4d211c2b02f9e5acde0737bceb0f010843bc81c285fd16
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/4.0.2 CPython/3.9.1

Release history Release notifications | RSS feed

This release

1.0.0 This release

2 release files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page