Skip to main content

Quality control for phylogenetic pipelines using pytest

Project description

Phytest logo

pypi badge pipeline badge coverage badge docs badge black badge pre-commit badge ice-virus-example badge

Quality control for phylogenetic pipelines using pytest

Installation

Install phytest using pip:

pip install phytest

Usage

Phytest will run user defined tests against an alignment and tree file. Here we will create example data files to run our tests on.

Create an alignment fasta file example.fasta

>Sequence_A
ATGAGATCCCCGATAGCGAGCTAGCGATCGCAGCGACTCAGCAGCTACAGCGCAGAGGAGAGAGAGGCCCCTATTTACTAGAGCTCCAGATATAGNNTAG
>Sequence_B
ATGAGATCCCCGATAGCGAGCTAGXGATCGCAGCGACTCAGCAGCTACAGCGCAGAGGAGAGAGAGGCCCCTATTTACTAGAGCTCCAGATATAGNNTAG
>Sequence_C
ATGAGA--CCCGATAGCGAGCTAGCGATCGCAGCGACTCAGCAGCTACAGCGCAGAGGAGAGAGAGGCCCCTATTTACTAGAGCTCCAGATATAGNNTAG
>Sequence_D
ATGAGATCCCCGATAGCGAGCTAGCGATNNNNNNNNNNNNNNNNNTACAGCGCAGAGGAGAGAGAGGCCCCTATTTACTAGAGCTCCAGATATAGNNTAG

Create a tree newick file example.tree

(Sequence_A:1,Sequence_B:0.2,(Sequence_C:0.3,Sequence_D:0.4):0.5);

Writing a test file

We want to enforce the follow constraints on our data:
  1. The alignment has 4 sequences

  2. The sequences have a length of 100

  3. The sequences only contains the characters A, T, G, C, N and -

  4. The sequences are allowed to only contain single base deletions

  5. The longest stretch of Ns is 10

  6. The tree has 4 tips

  7. The tree is bifurcating

  8. There are no outlier branches in the tree

We can write these tests in a python files example.py

from phytest import Alignment, Sequence, Tree


def test_alignment_has_4_sequences(alignment: Alignment):
    alignment.assert_length(4)


def test_alignment_has_a_width_of_100(alignment: Alignment):
    alignment.assert_width(100)


def test_sequences_only_contains_the_characters(sequence: Sequence):
    sequence.assert_valid_alphabet(alphabet="ATGCN-")


def test_single_base_deletions(sequence: Sequence):
    sequence.assert_longest_stretch_gaps(max=1)


def test_longest_stretch_of_Ns_is_10(sequence: Sequence):
    sequence.assert_longest_stretch_Ns(max=10)


def test_tree_has_4_tips(tree: Tree):
    tree.assert_number_of_tips(4)


def test_tree_is_bifurcating(tree: Tree):
    tree.assert_is_bifurcating()


def test_outlier_branches(tree: Tree):
    # Here we create a custom function to detect outliers
    import statistics

    tips = tree.get_terminals()
    branch_lengths = [t.branch_length for t in tips]
    cut_off = statistics.mean(branch_lengths) + statistics.stdev(branch_lengths)
    for tip in tips:
        assert tip.branch_length < cut_off, f"Outlier tip '{tip.name}' (branch length = {tip.branch_length})!"

We can then run these test on our data with phytest:

phytest examples/example.py -a examples/data/example.fasta -t examples/data/example.tree

Generate a report by adding --report.

HTML Report

This report can be customised in future (see the pytest-html user guide).

From the output we can see several tests failed:

FAILED examples/example.py::test_sequences_only_contains_the_characters[Sequence_B] - AssertionError: Invalid pattern found in 'Sequence_B'!
FAILED examples/example.py::test_single_base_deletions[Sequence_C] - AssertionError: Longest stretch of '-' in 'Sequence_C' > 1!
FAILED examples/example.py::test_longest_stretch_of_Ns_is_10[Sequence_D] - AssertionError: Longest stretch of 'N' in 'Sequence_D' > 10!
FAILED examples/example.py::test_outlier_branches - AssertionError: Outlier tip 'Sequence_A' (branch length = 1.0)!

Results (0.07s):
    13 passed
    4 failed
        - examples/example.py:12 test_sequences_only_contains_the_characters[Sequence_B]
        - examples/example.py:16 test_single_base_deletions[Sequence_C]
        - examples/example.py:20 test_longest_stretch_of_Ns_is_10[Sequence_D]
        - examples/example.py:32 test_outlier_branches

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

phytest-0.1.7.tar.gz (11.7 kB view hashes)

Uploaded Source

Built Distribution

phytest-0.1.7-py3-none-any.whl (11.5 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page