In silico PCR tool
Project description
primerJinn has two main functions, it designs primers for a multiplex PCR of given target regions of a DNA sequence in a FASTA file and it performs in silico PCR given a list of primers and a reference FASTA file.
The scripts takes several arguments:
Program | Required | Parameter | Description | Default |
---|---|---|---|---|
Both | Y | input_file | The path to the input FASTA file. | NA |
primer design | Y | region_file | The path to the primer design region file. This file should have three columns: name, start position, and end position (1-based). It can be in either tsv or xlxs format. | NA |
Both | N | salt_concentration | Salt concentration (in nM, Ignored if Q5 True). | 50 |
Both | N | target_tm | The desired melting temperature (Tm) for the primers | 60C |
Both | N | output | The name of the output file. | 'MultiPlexPrimerSet' or 'in_silico_PCR' |
primer design | N | primer_len | The desired length of the primers. | 20 |
primer design | N | product_size_min | The desired min size for the PCR product. | 400 |
primer design | N | product_size_max | The desired max size for the PCR product. | 800 |
primer design | N | ret | The maximum number of primer pairs to return | 100 |
primer design | N | Q5 | A boolean indicating whether to use NEB Q5 hotstart polymerase settings for primer3 | TRUE |
primer design | N | background | The path to the mispriming library FASTA file | |
in silico PCR | N | product_size_max | Maximum length of PCR products in nucleotides. | 2000 |
in silico PCR | N | req_five | Require the 5' end of the primer to bind? | TRUE |
Dependencies
- Python 3
- BLAST+
Installation
pip install primerJinn
Multiplex primer generation example usage
getMultiPrimerSet \
--region_file "./example/primer_regions.tsv" \
--input_file "./example/ref.fasta" \
--target_tm 65 \
--primer_len 20 \
--product_size_min 400 \
--product_size_max 800 \
--ret 100 \
--Q5 \
--background "" \
--output "example"
###MultiPlexPrimerSet.xlxs
Forward Primer | Reverse Primer | Forward tm | Reverse tm | Product Size | Name | Forward Primer TM NEB | Reverse Primer TM NEB |
---|---|---|---|---|---|---|---|
GAGGAACACCACTAGTACCG | CTCGATGACTTTACGGCCAT | 65.08334 | 64.69482 | 675 | Target 1461045-1461291 | 64 | 64 |
CATGGGATATGGAGCGATCG | GGGGTCGTAGGAGATCTTGA | 65.95586 | 65.59987 | 791 | Target 490900-491416 | 65 | 65 |
CCGGTTGTCCATTCCGTTTA | CTGTACGTATTTGGGTTGCG | 64.17967 | 65.57867 | 454 | Target 1303831-1303911 | 65 | 64 |
GGATGCGAGCTATATCTCCG | AATACGCCGAGATGTGGATG | 65.15669 | 64.9819 | 458 | Target 1674182-1674222 | 65 | 65 |
CAACAGTTCATCCCGGTTCG | GACGGATTTGTCGCTCACTA | 64.88889 | 66.57304 | 759 | Target 2288681-2289242 | 66 | 64 |
GCCACCATCGAATATCTGGT | GCTCCAGGAAGGGAATCATC | 65.63736 | 65.01728 | 778 | Target 761007-761277 | 64 | 65 |
GCATACCGAACGTCACAGAT | ACGGTCACCTACAAAAACGG | 65.68941 | 65.23466 | 665 | Target 778990-779488 | 65 | 65 |
GCTCTTAAGGCTGGCAATCT | CGGTCACACTTTCGGTAAGA | 64.82047 | 65.53067 | 577 | Target 2154831-2154873 | 65 | 64 |
PCR in silico example usage
PCRinSilico \
--primer_seq ./example/primers.txt \
--target_tm 50 \
--ref_fasta_file ./example/ref.fasta
in_silico_PCR.tsv
qseq1 | qseq1_input | qstart1 | qend1 | direction1 | mismatch1 | qseq2 | qseq2_input | qstart2 | qend2 | direction2 | mismatch2 | binding_pos_diff | reference | ref_region | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
p1 | GAGGAACACCACTAGTACCG | 1 | 20 | + | 0 | p9 | CTCGATGACTTTACGGCCAT | 1 | 20 | - | 0 | 655 | NC_000962.3 | 1461637 | 1460982 |
p2 | CATGGGATATGGAGCGATCG | 1 | 20 | + | 0 | p10 | GGGGTCGTAGGAGATCTTGA | 1 | 20 | - | 0 | 771 | NC_000962.3 | 491474 | 490703 |
p3 | CCGGTTGTCCATTCCGTTTA | 1 | 20 | + | 0 | p11 | CTGTACGTATTTGGGTTGCG | 1 | 20 | - | 0 | 434 | NC_000962.3 | 1304111 | 1303677 |
p4 | GGATGCGAGCTATATCTCCG | 1 | 20 | + | 0 | p12 | AATACGCCGAGATGTGGATG | 1 | 20 | - | 0 | 438 | NC_000962.3 | 1674558 | 1674120 |
p5 | CAACAGTTCATCCCGGTTCG | 1 | 20 | + | 0 | p13 | GACGGATTTGTCGCTCACTA | 1 | 20 | - | 0 | 739 | NC_000962.3 | 2289391 | 2288652 |
p6 | GCCACCATCGAATATCTGGT | 1 | 20 | + | 0 | p14 | GCTCCAGGAAGGGAATCATC | 1 | 20 | - | 0 | 758 | NC_000962.3 | 761564 | 760806 |
p7 | GCATACCGAACGTCACAGAT | 1 | 20 | + | 0 | p15 | ACGGTCACCTACAAAAACGG | 1 | 20 | - | 0 | 645 | NC_000962.3 | 779595 | 778950 |
p8 | GCTCTTAAGGCTGGCAATCT | 1 | 20 | + | 0 | p16 | CGGTCACACTTTCGGTAAGA | 1 | 20 | - | 0 | 557 | NC_000962.3 | 2155289 | 2154732 |
in_silico_PCR_amplicon_interactions.tsv
amplicon1_PF | amplicon1_PR | amplicon2_PF | amplicon2_PR | tm |
---|---|---|---|---|
kkd_F_2 | sge_R | kkd_R | sge_R | 90.22726832 |
in_silico_PCR_primer_dimears.tsv
Sequence1 | Sequence2 | MeltingTemp |
---|---|---|
p1 | p2 | 73 |
p1 | p3 | 74 |
p1 | p4 | 73 |
p1 | p5 | 73 |
p1 | p6 | 73 |
p1 | p7 | 72 |
p1 | p8 | 73 |
p1 | p9 | 73 |
p1 | p10 | 74 |
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
primerJinn-0.1.2.dev1.tar.gz
(4.2 kB
view details)
Built Distribution
File details
Details for the file primerJinn-0.1.2.dev1.tar.gz
.
File metadata
- Download URL: primerJinn-0.1.2.dev1.tar.gz
- Upload date:
- Size: 4.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.9.12
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | e148bf9bc96b40f32e99dbb2e4b3bdb6c4a3fda7c38878f3570578f85d241bc4 |
|
MD5 | 3511f6a60614cdc20d1393f1778ca7e5 |
|
BLAKE2b-256 | 1cd51a3d57b4daab656632f10e38cdcd9af725398ef9dc8f215827203eab5319 |
File details
Details for the file primerJinn-0.1.2.dev1-py3-none-any.whl
.
File metadata
- Download URL: primerJinn-0.1.2.dev1-py3-none-any.whl
- Upload date:
- Size: 3.9 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.9.12
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 9b9dfb9b9259dbb2cccc1ac7a70137df8f7c4ebc90879a4798157c3583eb486f |
|
MD5 | c9b1012ae4f9a5ffc7cb47e061e41b4f |
|
BLAKE2b-256 | 8500c16fc64375be06e6e590982b2e6ff0aac16fc84aa9a19ba29c6098a6a1b9 |