primerJinn 1.0.2

In silico PCR tool

primerJinn has two main functions, it designs primers for a multiplex PCR of given target regions of a DNA sequence in a FASTA file and it performs in silico PCR given a list of primers and a reference FASTA file.

The scripts takes several arguments:

Program	Required	Parameter	Description	Default
Both	Y	input_file	The path to the input FASTA file.	NA
primer design	Y	region_file	The path to the primer design region file. This file should have three columns: name, start position, and end position (1-based). It can be in either tsv or xlxs format.	NA
Both	N	salt_concentration	Salt concentration (in nM, Ignored if Q5 True).	50
Both	N	target_tm	The desired melting temperature (Tm) for the primers	60C
Both	N	output	The name of the output file.	'MultiPlexPrimerSet' or 'in_silico_PCR'
primer design	N	primer_len	The desired length of the primers.	20
primer design	N	product_size_min	The desired min size for the PCR product.	400
primer design	N	product_size_max	The desired max size for the PCR product.	800
primer design	N	ret	The maximum number of primer pairs to return	100
primer design	N	Q5	A boolean indicating whether to use NEB Q5 hotstart polymerase settings for primer3	TRUE
primer design	N	background	The path to the mispriming library FASTA file
primer design	N	ill_adapt	Add Illumina partial adapters	FALSE
primer design	N	clamp	Require GC clamp	0
primer design	N	poly	Maximum allowable length of a mononucleotide repeat (poly-X) in the primer sequence	3
in silico PCR	N	product_size_max	Maximum length of PCR products in nucleotides.	2000
in silico PCR	N	req_five	Require the 5' end of the primer to bind?	TRUE

Dependencies

• Python 3
• BLAST+

Installation

pip install primerJinn

Multiplex primer generation example usage

getMultiPrimerSet \
    --region_file "./example/primer_regions.tsv" \
    --input_file "./example/ref.fasta" \
    --target_tm 65 \
    --primer_len 20 \
    --product_size_min 400 \
    --product_size_max 800 \
    --ret 100 \
    --Q5 \
    --background "" \
    --output "example"

###MultiPlexPrimerSet.xlxs

Forward Primer	Reverse Primer	Forward tm	Reverse tm	Product Size	Name	Forward Primer TM NEB	Reverse Primer TM NEB
GAGGAACACCACTAGTACCG	CTCGATGACTTTACGGCCAT	65.08334	64.69482	675	Target 1461045-1461291	64	64
CATGGGATATGGAGCGATCG	GGGGTCGTAGGAGATCTTGA	65.95586	65.59987	791	Target 490900-491416	65	65
CCGGTTGTCCATTCCGTTTA	CTGTACGTATTTGGGTTGCG	64.17967	65.57867	454	Target 1303831-1303911	65	64
GGATGCGAGCTATATCTCCG	AATACGCCGAGATGTGGATG	65.15669	64.9819	458	Target 1674182-1674222	65	65
CAACAGTTCATCCCGGTTCG	GACGGATTTGTCGCTCACTA	64.88889	66.57304	759	Target 2288681-2289242	66	64
GCCACCATCGAATATCTGGT	GCTCCAGGAAGGGAATCATC	65.63736	65.01728	778	Target 761007-761277	64	65
GCATACCGAACGTCACAGAT	ACGGTCACCTACAAAAACGG	65.68941	65.23466	665	Target 778990-779488	65	65
GCTCTTAAGGCTGGCAATCT	CGGTCACACTTTCGGTAAGA	64.82047	65.53067	577	Target 2154831-2154873	65	64

There is an online version of primerJinn getMultiPrimerSet available at DrDx.Me

Notes

When testing the primers for a targeted diagnostic assay, we would recommend doing a qPCR using individual primers and reagents intended for the PCR, and adding in EVA Green plus (20X in water) and ROX (50X). This will allow you see the relative efficiency of each primer, and investigate the melt curves, the products can also be run on an agarose gel to confirm single bands.

PCR in silico example usage

PCRinSilico \
   --primer_seq ./example/primers.txt \
   --target_tm 50 \
   --input_file ./example/ref.fasta

in_silico_PCR.tsv

qseq1	qseq1_input	qstart1	qend1	direction1	mismatch1	qseq2	qseq2_input	qstart2	qend2	direction2	mismatch2	binding_pos_diff	reference	ref_region
p1	GAGGAACACCACTAGTACCG	1	20	+	0	p9	CTCGATGACTTTACGGCCAT	1	20	-	0	655	NC_000962.3	1461637	1460982
p2	CATGGGATATGGAGCGATCG	1	20	+	0	p10	GGGGTCGTAGGAGATCTTGA	1	20	-	0	771	NC_000962.3	491474	490703
p3	CCGGTTGTCCATTCCGTTTA	1	20	+	0	p11	CTGTACGTATTTGGGTTGCG	1	20	-	0	434	NC_000962.3	1304111	1303677
p4	GGATGCGAGCTATATCTCCG	1	20	+	0	p12	AATACGCCGAGATGTGGATG	1	20	-	0	438	NC_000962.3	1674558	1674120
p5	CAACAGTTCATCCCGGTTCG	1	20	+	0	p13	GACGGATTTGTCGCTCACTA	1	20	-	0	739	NC_000962.3	2289391	2288652
p6	GCCACCATCGAATATCTGGT	1	20	+	0	p14	GCTCCAGGAAGGGAATCATC	1	20	-	0	758	NC_000962.3	761564	760806
p7	GCATACCGAACGTCACAGAT	1	20	+	0	p15	ACGGTCACCTACAAAAACGG	1	20	-	0	645	NC_000962.3	779595	778950
p8	GCTCTTAAGGCTGGCAATCT	1	20	+	0	p16	CGGTCACACTTTCGGTAAGA	1	20	-	0	557	NC_000962.3	2155289	2154732

in_silico_PCR_amplicon_interactions.tsv

amplicon1_PF	amplicon1_PR	amplicon2_PF	amplicon2_PR	tm
kkd_F_2	sge_R	kkd_R	sge_R	90.22726832

in_silico_PCR_primer_dimears.tsv

Sequence1	Sequence2	MeltingTemp
p1	p2	73
p1	p3	74
p1	p4	73
p1	p5	73
p1	p6	73
p1	p7	72
p1	p8	73
p1	p9	73
p1	p10	74

Citation

(Limberis, J.D., Metcalfe, J.Z. primerJinn: a tool for rationally designing multiplex PCR primer sets for amplicon sequencing and performing in silico PCR. BMC Bioinformatics 24, 468 (2023).)[https://doi.org/10.1186/s12859-023-05609-1]