Create PCR primers with optimal lengths, tms, gc%s and free energies
Project description
primers
This is a tool for creating PCR primers. It has an emphasis on DNA assembly and makes it easy to add sequences to the end of PCR fragments. This is part of overlap extension polymerase chain reaction and preparing unstandardized DNA sequences for Gibson assembly and Golden gate cloning.
primers
quickly creates pairs with optimized lengths, Tms, GC ratios, secondary structures (minimum free energies) and without off-target binding sites. Each returned primer has two tms: "tm", the melting temperature for the portion of the primer that binds to the template sequence, and "tm_total", the melting temperature for the entire primer with additional sequence added to its 5' end.
Unlike the most used alternative, Primer3, primers
has a permissive MIT license and support for adding sequence to the 5' ends of primers.
Installation
pip install primers
Usage
Python
from primers import primers # add enzyme recognition sequences to FWD and REV primers: BsaI, BpiI fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGTCTC" add_rev="GAAGAC") print(fwd.fwd) # True print(fwd.seq) # GGTCTCAATGAGACAATAGCACACACA; 5' to 3' print(fwd.tm) # 62.4; melting temp print(fwd.tm_total) # 68.6; melting temp with added seq (GGTCTC) print(fwd.dg) # -1.86; minimum free energy of the secondary structure # add from a range of sequence to the FWD primer: [5, 12] bp add_fwd = "GGATCGAGCTTGA" fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd=add_fwd, add_fwd_len=(5, 12)) print(fwd.seq) # AGCTTGAAATGAGACAATAGCACACACAGC print(fwd.tm) # 62.2 print(fwd.tm_total) # 70.0
CLI
$ primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -f GGTCTC -r GAAGAC dir tm ttm dg pen seq FWD 62.4 68.6 -1.86 5.43 GGTCTCAATGAGACAATAGCACACACA REV 62.8 67.4 0 4.8 GAAGACTTTCGTATGCTGACCTAG
$ primers --help usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [--version] SEQ Create PCR primers for a DNA sequence. Logs the FWD and REV primer with columns: dir, tm, ttm, dg, pen, seq Where: dir = FWD or REV. tm = Melting temperature of the annealing/binding part of the primer (Celsius). ttm = The total melting temperature of the primer with added seq (Celsius). dg = The minimum free energy of the primer's secondary structure (kcal/mol). pen = The primer's penalty score. Lower is better. seq = The sequence of the primer in the 5' to the 3' direction. positional arguments: SEQ DNA sequence optional arguments: -h, --help show this help message and exit -f SEQ additional sequence to add to FWD primer (5' to 3') -fl INT INT space separated min-max range for the length to add from '-f' (5' to 3') -r SEQ additional sequence to add to REV primer (5' to 3') -rl INT INT space separated min-max range for the length to add from '-r' (5' to 3') -t SEQ sequence to check for offtargets binding sites --version show program's version number and exit
Algorithm
Creating primers for a DNA sequence is non-trivial because it's multi-objective optimization. Ideally pairs of primers for PCR amplification would have similar tms, GC ratios close to 0.5, high minimum free energies (dg), and a lack off-target binding sites. In primers
, like Primer3, this is accomplished with a linear function that penalizes undesired characteristics. The primer pair with the lowest combined penalty is created.
Scoring
The penalty for each possible primer, p, is calculated as:
PENALTY(p) = abs(p.tm - opt_tm) * penalty_tm + abs(p.gc - opt_gc) * penalty_gc + abs(len(p) - opt_len) * penalty_len + abs(p.tm - p.pair.tm) * penalty_tm_diff + abs(p.dg) * penalty_dg + p.offtargets * penalty_offtarget
Each of the optimal (opt_*
) and penalty (penalty_*
) parameters is adjustable through the primers.primers()
function. The defaults are below.
opt_tm: float = 62.0 opt_gc: float = 0.5 opt_len: int = 22 penalty_tm: float = 1.0 penalty_gc: float = 3.0 penalty_len: float = 1.0 penalty_tm_diff: float = 1.0 penalty_dg: float = 2.0 penalty_offtarget: float = 20.0
Off-targets
Off-targets are defined as a subsequence within one mismatch of the last 10bp of a primer's 3' end. This is experimentally supported by:
Wu, J. H., Hong, P. Y., & Liu, W. T. (2009). Quantitative effects of position and type of single mismatch on single base primer extension. Journal of microbiological methods, 77(3), 267-275
By default, primers are checked for off-targets within the seq
parameter passed to primers.primers(seq)
. But the primers can be checked against another sequence if it's passed through the offtarget_check
argument. This is useful when PCR'ing a subsequence of a larger DNA sequence; for example: a plasmid.
seq = "AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA" parent = "ggaattacgtAATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAAggaccagttacagga" # primers are checked for offtargets in `parent` fwd, rev = primers(seq, offtarget_check=parent)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.