Skip to main content

primers

This is a small, straightforward tool for creating PCR primers. Its target use-case is DNA assembly.

Reasons to choose primers instead of Primer3 include its:

  • features: It is uniquely focused on DNA assembly flows like Gibson Assembly and Golden Gate cloning. You can design primers while adding sequence to the 5' ends of primers.
  • simplicity: It is a small and simple Python CLI/library with a single dependency (seqfold). It is easier to install and use.
  • interface: The Python library accepts and create primers for Biopython Seq classes. It outputs JSON for easy integration with other applications.
  • license: It has a permissive, business-friendly license (MIT) instead of a copyleft GPL v2 license.

Installation

pip install primers

Usage

primers chooses pairs while optimizing for length, tm, GC ratio, secondary structure, and off-target binding. In the simplest case, you just pass the sequence you want to amplify:

$ primers create CTACTAATAGCACACACGGGGACTAGCATCTATCTCAGCTACGATCAGCATC
  dir    tm   ttm  gc     dg     p  seq
  FWD  63.6  63.6 0.5      0   2.6  CTACTAATAGCACACACGGG
  REV  63.2  63.2 0.5  -0.16  1.52  GATGCTGATCGTAGCTGAGATA

Additional sequence is added to the 5' end of primers via the add_fwd/add_rev args (-f/-r with CLI). By default, it will prepend the entire additional sequence. If you want it to choose the best subsequence to add to the 5' end (factoring in the features dicussed below), allow it to choose from a range of indicies via the add_fwd_len/add_rev_len (-fl/-rl with CLI). Each primer has two tms: "tm", the melting temperature for the portion of the primer that binds to the template sequence and "tm_total", the melting temperature for the entire primer including the additional sequence added to primers' 5' end.

Python

from primers import create

# add enzyme recognition sequences to FWD and REV primers: BsaI, BpiI
fwd, rev = create("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGTCTC", add_rev="GAAGAC")
print(fwd.fwd)      # True
print(fwd.seq)      # GGTCTCAATGAGACAATAGCACACACA; 5' to 3'
print(fwd.tm)       # 62.4; melting temp
print(fwd.tm_total) # 68.6; melting temp with added seq (GGTCTC)
print(fwd.dg)       # -1.86; minimum free energy of the secondary structure

# add from a range of sequence to the FWD primer: [5, 12] bp
fwd, rev = create("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGATCGAGCTTGA", add_fwd_len=(5, 12))
print(fwd.seq)      # AGCTTGAAATGAGACAATAGCACACACAGC (AGCTTGA added from add_fwd)
print(fwd.tm)       # 62.2
print(fwd.tm_total) # 70.0

CLI

$ primers create --help
usage: primers create [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [-j | --json | --no-json] SEQ

positional arguments:
  SEQ                   create primers to amplify this sequence

options:
  -h, --help            show this help message and exit
  -f SEQ                additional sequence to add to FWD primer (5' to 3')
  -fl INT INT           space separated min-max range for the length to add from '-f' (5' to 3')
  -r SEQ                additional sequence to add to REV primer (5' to 3')
  -rl INT INT           space separated min-max range for the length to add from '-r' (5' to 3')
  -t SEQ                sequence to check for off-target binding sites
  -j, --json, --no-json
                        write the primers to a JSON array

Table Output Format

By default, the primers are logged in table format in rows of dir, tm, ttm, gc, dg, p, seq where:

  • dir: FWD or REV
  • tm: the melting temperature of the annealing portion of the primer (Celsius)
  • ttm: the total melting temperature of the primer with added seq (Celsius)
  • gc: the GC ratio of the primer
  • dg: the minimum free energy of the primer (kcal/mol)
  • p: the primer's penalty score. Lower is better
  • seq: the sequence of the primer in the 5' to the 3' direction
$ primers create -f GGTCTC -r GAAGAC AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA
  dir    tm   ttm  gc     dg     p  seq
  FWD  60.8  67.0 0.5  -1.86  5.93  GGTCTCAATGAGACAATAGCACACAC
  REV  60.8  65.8 0.5      0   3.2  GAAGACTTTCGTATGCTGACCTAG

JSON Output Format

The --json flag prints primers in JSON format with more details on scoring. The example below is truncated for clarity:

$ primers create CTACTAATAGCACACACGGGGACTAGCATCTATCTCAGCTACGATCAGCATC --json| jq
[
  {
    "seq": "CTACTAATAGCACACACGGG",
    "len": 20,
    "tm": 63.6,
    "tm_total": 63.6,
    "gc": 0.5,
    "dg": 0,
    "fwd": true,
    "off_target_count": 0,
    "scoring": {
      "penalty": 2.6,
      "penalty_tm": 1.6,
      "penalty_tm_diff": 0,
      "penalty_gc": 0,
      "penalty_len": 1,
      "penalty_dg": 0,
      "penalty_off_target": 0
    }
  },
...

Algorithm

Choosing PCR primers requires optimizing for a few different characteristics. Ideally, pairs of primers for PCR amplification would have similar tms, GC ratios close to 0.5, high minimum free energies (dg), and a lack off-target binding sites. In primers, like Primer3, choosing amongst those (sometimes competing) goals is accomplished with a linear function that penalizes undesirable characteristics. The primer pair with the lowest combined penalty is chosen.

Scoring

The penalty for each possible primer, p, is calculated as:

PENALTY(p) =
    abs(p.tm - optimal_tm) * penalty_tm +     // penalize each deg of suboptimal melting temperature
    abs(p.gc - optimal_gc) * penalty_gc +     // penalize each percentage point of suboptimal GC ratio
    abs(len(p) - optimal_len) * penalty_len + // penalize each bp of suboptimal length
    abs(p.tm - p.pair.tm) * penalty_tm_diff + // penalize each deg of melting temperature diff between primers
    abs(p.dg) * penalty_dg +                  // penalize each kcal/mol of free energy in secondary structure
    p.offtarget_count * penalty_offtarget     // penalize each off-target binding site

Each of the optimal (optimal_*) and penalty (penalty_*) parameters is adjustable in the primers.create() function. The defaults are below:

optimal_tm: float = 62.0
optimal_gc: float = 0.5
optimal_len: int = 22
penalty_tm: float = 1.0
penalty_gc: float = 0.2
penalty_len: float = 0.5
penalty_tm_diff: float = 1.0
penalty_dg: float = 2.0
penalty_offtarget: float = 20.0

Scoring Existing Primers

If you already have primers, and you want to see their features and penalty score, use the primers score command. The command below scores a FWD and REV primer against the sequence -s that they were created to amplify:

$ primers score GGTCTCAATGAGACAATA TTTCGTATGCTGACCTAG -s AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAATTT --json | jq
[
  {
    "seq": "GGTCTCAATGAGACAATA",
    "len": 18,
    "tm": 39.4,
    "tm_total": 55,
    "gc": 0.4,
    "dg": -1.86,
    "fwd": true,
    "off_target_count": 0,
    "scoring": {
      "penalty": 49.9,
      "penalty_tm": 22.6,
      "penalty_tm_diff": 19.6,
      "penalty_gc": 2,
      "penalty_len": 2,
      "penalty_dg": 3.7,
      "penalty_off_target": 0
    }
  },
  {
    "seq": "TTTCGTATGCTGACCTAG",
    "len": 18,
    "tm": 59,
    "tm_total": 59,
    "gc": 0.5,
    "dg": 0,
    "fwd": false,
    "off_target_count": 0,
    "scoring": {
      "penalty": 24.6,
      "penalty_tm": 3,
      "penalty_tm_diff": 19.6,
      "penalty_gc": 0,
      "penalty_len": 2,
      "penalty_dg": 0,
      "penalty_off_target": 0
    }
  }
]

Off-target Binding Sites

Usually, off-target binding sites should be avoided. In primers, off-target binding sites are those with <= 1 mismatch in the last 10 bair pairs of the primer's 3' end. This definition is experimentally supported by:

Wu, J. H., Hong, P. Y., & Liu, W. T. (2009). Quantitative effects of position and type of single mismatch on single base primer extension. Journal of microbiological methods, 77(3), 267-275

By default, primers are checked for off-targets within the seq parameter passed to create(seq). But the primers can be checked against another sequence if it is passed to the optional offtarget_check argument (-t for CLI). This is useful when PCR'ing a subsequence of a larger DNA sequence like a plasmid.

from primers import create

seq = "AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA"
seq_parent = "ggaattacgtAATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAAggaccagttacagga"

# primers are checked for offtargets in `seq_parent`
fwd, rev = create(seq, offtarget_check=seq_parent)

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

primers-0.5.10.tar.gz (17.2 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

primers-0.5.10-py3-none-any.whl (15.7 kB view details)

Uploaded Python 3

File details

Details for the file primers-0.5.10.tar.gz.

File metadata

  • Download URL: primers-0.5.10.tar.gz
  • Upload date:
  • Size: 17.2 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.0.0 CPython/3.9.13

File hashes

Hashes for primers-0.5.10.tar.gz
Algorithm Hash digest
SHA256 3ff2cd4c27a47326faeb8e54f36649752e6905109fdd3b22b90c2c167233f060
MD5 da76351919b92e8abe52e38a6d8b3d35
BLAKE2b-256 77b583158c3b26db0a8cadccdbcaa48c2bd41acd1d4ed9772593c742eec672a0

See more details on using hashes here.

File details

Details for the file primers-0.5.10-py3-none-any.whl.

File metadata

  • Download URL: primers-0.5.10-py3-none-any.whl
  • Upload date:
  • Size: 15.7 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.0.0 CPython/3.9.13

File hashes

Hashes for primers-0.5.10-py3-none-any.whl
Algorithm Hash digest
SHA256 96c4554f2541cabcbc6368e1d3f14776b560fb16cfd7d94a65fc7df1fe7dac57
MD5 33a7b3314a1257fa8abc127e8991a2a3
BLAKE2b-256 4148f973ed5cace090f5689be05ac27910e1503e2296f0ed3affd75f47d40c03

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.5.10 This release

2 files

0.5.9

1 file

0.5.8

1 file

0.5.7

1 file

0.5.6

1 file

0.5.5

1 file

0.5.4

2 files

0.5.3

3 files

0.5.2

3 files

0.5.1

3 files

0.5.0

3 files

0.4.0

3 files

0.3.3

3 files

0.3.2

3 files

0.2.8

3 files

0.2.7

2 files

0.2.6

3 files

0.2.5

2 files

0.2.4

2 files

0.2.3

2 files

0.2.2

2 files

0.2.1

2 files

0.2.0

2 files

0.1.3

3 files

0.1.2

3 files

0.1.1

3 files

0.1.0

2 files

0.0.2

3 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page