Skip to main content

Create PCR primers optimized for length, tm, gc and free energy

Project description


from primers import pcr, Primer

# create a FWD and REV primer
    add_fwd="GGTAGGTAGAT", add_rev="GGTTTTAGGATAGAT", add_min=10, add_max=25,
    opt_tm=55.0, opt_len=30)

ps[0] # Primer("GGTAGGTAGATATGGATGGT", tm=62.3)
ps[1] # Primer("GGTTTTAGGATAGATCCTACTATCT", tm=64.0)

Project details

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for primers, version 0.1.1
Filename, size File type Python version Upload date Hashes
Filename, size primers-0.1.1-py3.8.egg (20.4 kB) File type Egg Python version 3.8 Upload date Hashes View
Filename, size primers-0.1.1-py3-none-any.whl (10.0 kB) File type Wheel Python version py3 Upload date Hashes View
Filename, size primers-0.1.1.tar.gz (8.5 kB) File type Source Python version None Upload date Hashes View

Supported by

AWS AWS Cloud computing Datadog Datadog Monitoring DigiCert DigiCert EV certificate Facebook / Instagram Facebook / Instagram PSF Sponsor Fastly Fastly CDN Google Google Object Storage and Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Salesforce Salesforce PSF Sponsor Sentry Sentry Error logging StatusPage StatusPage Status page