Skip to main content

Create PCR primers optimized for length, tm, gc and free energy

Project description

primers

This is a tool for making PCR primers for DNA sequences. primers' emphasis is on ease-of-use and DNA assembly. Adding additional sequence to 5' end of the FWD and REV primer, something common in creating fragments for Gibson assembly and Golden Gate cloning, is easy with primers. Finally, it has a permissive MIT license where other primer design tools don't.

Installation

pip install primers

Usage

Python

from primers import primers

# add recognition sequences to FWD and REV primers
fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGTCTC" add_rev="GAAGAC")
print(fwd.fwd)  # True
print(fwd.seq)  # GGTCTCAATGAGACAATAGCACACACA; 5' to 3'
print(fwd.tm)   # 62.4; melting temp
print(fwd.tm_total)  # 68.6; melting temp with added seq (GGTCTC)
print(fwd.dg)   # -1.86; minimum free energy of the secondary structure

# add from a range of sequence to the FWD primer
fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGATCGAGCTTGA", add_fwd_len=(5, 12))
print(fwd.seq)  # AGCTTGAAATGAGACAATAGCACACACAGC
print(fwd.tm)   # 62.2
print(fwd.tm_total)  # 70.0

CLI

$ primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -f GGTCTC -r GAAGAC
  dir    tm   ttm     dg   pen  seq
  FWD  62.4  68.6  -1.86  5.43  GGTCTCAATGAGACAATAGCACACACA
  REV  62.8  67.4      0   4.8  GAAGACTTTCGTATGCTGACCTAG
$ primers --help
usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [--version] SEQ

Create PCR primers for a DNA sequence.

Logs the FWD and REV primer with columns:
dir, tm, ttm, dg, pen, seq

Where:
dir = FWD or REV.
tm  = Melting temperature of the annealing/binding part of the primer (Celsius).
ttm = The total melting temperature of the primer with added seq (Celsius).
dg  = The minimum free energy of the primer (kcal/mol).
pen = The primer's penalty score. Lower is better.
seq = The sequence of the primer in the 5' to the 3' direction.

positional arguments:
  SEQ                   DNA sequence

optional arguments:
  -h, --help            show this help message and exit
  -f SEQ, --fwd SEQ     additional sequence to add to FWD primer (5' to 3')
  -fl INT INT, --flen INT INT
                        space separated min-max range for the length to add from 'add_fwd' (5' to 3')
  -r SEQ, --rev SEQ     additional sequence to add to REV primer (5' to 3')
  -rl INT INT, --rlen INT INT
                        space separated min-max range for the length to add from 'add_rev' (5' to 3')
  --version             show program's version number and exit

Overview

Selecting primers for a DNA sequence is non-trivial because it's a multi-objective optimization problem. Ideally, pairs of primers for PCR amplification would have similar, ideal tms, low gc%s, low free energies (dgs) and lack off-target binding sites.

Scoring

In this module, the penalty for each possible primer, p, is calculated as:

PENALTY(p) =
    abs(p.tm - opt_tm) * penalty_tm +
    abs(p.gc - opt_gc) * penalty_gc +
    abs(len(p) - opt_len) * penalty_len +
    abs(p.tm - p.pair.tm) * penalty_tm_diff +
    abs(p.dg) * penalty_dg +
    p.offtargets * penalty_offtargets

Each of the optimal (opt_*) and penalty (penalty_*) parameters is adjustable through the primers.primers() function. The primer pair with the lowest combined penalty score is chosen.

Given this module's emphasis on DNA assembly, additional sequences added to the FWD and/or REV primer are considered in the PENALTY calculation.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

primers-0.1.2.tar.gz (10.1 kB view hashes)

Uploaded Source

Built Distributions

primers-0.1.2-py3.8.egg (20.2 kB view hashes)

Uploaded Source

primers-0.1.2-py3-none-any.whl (11.2 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page