Skip to main content
Python Software Foundation 20th Year Anniversary Fundraiser  Donate today!

Create PCR primers optimized for length, tm, gc and free energy

Project description


This is a tool for making PCR primers for DNA sequences. primers' emphasis is on ease-of-use and DNA assembly. Adding additional sequence to 5' end of the FWD and REV primer is easy with primers. This is a common requirement for Gibson assembly and Golden Gate cloning. Finally, it has a permissive MIT license where other primer design tools, like Primer3, don't.


pip install primers



from primers import primers

# add enzyme recognition sequences to FWD and REV primers: BsaI, BpiI
print(fwd.fwd)  # True
print(fwd.seq)  # GGTCTCAATGAGACAATAGCACACACA; 5' to 3'
print(   # 62.4; melting temp
print(fwd.tm_total)  # 68.6; melting temp with added seq (GGTCTC)
print(fwd.dg)   # -1.86; minimum free energy of the secondary structure

# add from a range of sequence to the FWD primer: [5, 12] bp
fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd=add_fwd, add_fwd_len=(5, 12))
print(   # 62.2
print(fwd.tm_total)  # 70.0


  dir    tm   ttm     dg   pen  seq
  REV  62.8  67.4      0   4.8  GAAGACTTTCGTATGCTGACCTAG
$ primers --help
usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [--version] SEQ

Create PCR primers for a DNA sequence.

Logs the FWD and REV primer with columns:
    dir, tm, ttm, dg, pen, seq

    dir = FWD or REV.
    tm  = Melting temperature of the annealing/binding part of the primer (Celsius).
    ttm = The total melting temperature of the primer with added seq (Celsius).
    dg  = The minimum free energy of the primer's secondary structure (kcal/mol).
    pen = The primer's penalty score. Lower is better.
    seq = The sequence of the primer in the 5' to the 3' direction.

positional arguments:
  SEQ          DNA sequence

optional arguments:
  -h, --help   show this help message and exit
  -f SEQ       additional sequence to add to FWD primer (5' to 3')
  -fl INT INT  space separated min-max range for the length to add from '-f' (5' to 3')
  -r SEQ       additional sequence to add to REV primer (5' to 3')
  -rl INT INT  space separated min-max range for the length to add from '-r' (5' to 3')
  -t SEQ       sequence to check for offtargets binding sites
  --version    show program's version number and exit


Creating primers for a DNA sequence is non-trivial because it's multi-objective optimization. Ideally pairs of primers for PCR amplification would have similar tms, GC ratios close to 0.5, high minimum free energies (dg), and a lack off-target binding sites. In primers, like Primer3, this is accomplished with a formula in which undesired primer characteristics are penalized. The primer pair with the lowest penalty score is created.


The penalty for each possible primer, p, is calculated as:

    abs( - opt_tm) * penalty_tm +
    abs(p.gc - opt_gc) * penalty_gc +
    abs(len(p) - opt_len) * penalty_len +
    abs( - * penalty_tm_diff +
    abs(p.dg) * penalty_dg +
    p.offtargets * penalty_offtarget

Each of the optimal (opt_*) and penalty (penalty_*) parameters is adjustable through the primers.primers() function. The defaults are below.

opt_tm: float = 62.0
opt_gc: float = 0.5
opt_len: int = 22
penalty_tm: float = 1.0
penalty_gc: float = 3.0
penalty_len: float = 1.0
penalty_tm_diff: float = 1.0
penalty_dg: float = 2.0
penalty_offtarget: float = 20.0


Offtargets are defined as a subsequence within one mismatch of the last 10bp of a primer's 3' end. This is experimentally supported by:

Wu, J. H., Hong, P. Y., & Liu, W. T. (2009). Quantitative effects of position and type of single mismatch on single base primer extension. Journal of microbiological methods, 77(3), 267-275

By default, primers are checked for offtargets within the seq parameter passed to primers.primers(seq). But the primers can be checked against another sequence if it's passed through the offtarget_check argument. This is useful when PCR'ing a subsequence of a larger DNA sequence; for example: a plasmid.


# primers are checked for offtargets in `parent`
fwd, rev = primers(seq, offtarget_check=parent)

Project details

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for primers, version 0.2.2
Filename, size File type Python version Upload date Hashes
Filename, size primers-0.2.2-py3-none-any.whl (13.1 kB) File type Wheel Python version py3 Upload date Hashes View
Filename, size primers-0.2.2.tar.gz (12.2 kB) File type Source Python version None Upload date Hashes View

Supported by

AWS AWS Cloud computing Datadog Datadog Monitoring DigiCert DigiCert EV certificate Facebook / Instagram Facebook / Instagram PSF Sponsor Fastly Fastly CDN Google Google Object Storage and Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Salesforce Salesforce PSF Sponsor Sentry Sentry Error logging StatusPage StatusPage Status page