Skip to main content

Create PCR primers with optimal lengths, tms, gc%s and free energies

Project description

primers

This is a tool for creating PCR primers. It has an emphasis on DNA assembly and makes it easy to add sequences to the end of PCR fragments. This is part of overlap extension polymerase chain reaction and preparing unstandardized DNA sequences for Gibson assembly and Golden gate cloning.

primers quickly creates pairs with optimized lengths, Tms, GC ratios, secondary structures (minimum free energies) and without off-target binding sites. Each returned primer has two tms: "tm", the melting temperature for the portion of the primer that binds to the template sequence, and "tm_total", the melting temperature for the entire primer with additional sequence added to its 5' end.

Unlike the most used alternative, Primer3, primers has a permissive MIT license and support for adding sequence to the 5' ends of primers.

Installation

pip install primers

Usage

Python

from primers import primers

# add enzyme recognition sequences to FWD and REV primers: BsaI, BpiI
fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGTCTC", add_rev="GAAGAC")
print(fwd.fwd)  # True
print(fwd.seq)  # GGTCTCAATGAGACAATAGCACACACA; 5' to 3'
print(fwd.tm)   # 62.4; melting temp
print(fwd.tm_total)  # 68.6; melting temp with added seq (GGTCTC)
print(fwd.dg)   # -1.86; minimum free energy of the secondary structure

# add from a range of sequence to the FWD primer: [5, 12] bp
add_fwd = "GGATCGAGCTTGA"
fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd=add_fwd, add_fwd_len=(5, 12))
print(fwd.seq)  # AGCTTGAAATGAGACAATAGCACACACAGC
print(fwd.tm)   # 62.2
print(fwd.tm_total)  # 70.0

CLI

$ primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -f GGTCTC -r GAAGAC
  dir    tm   ttm     dg   pen  seq
  FWD  62.4  68.6  -1.86  5.43  GGTCTCAATGAGACAATAGCACACACA
  REV  62.8  67.4      0   4.8  GAAGACTTTCGTATGCTGACCTAG
$ primers --help
usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [--version] SEQ

Create PCR primers for a DNA sequence.

Logs the FWD and REV primer with columns:
    dir, tm, ttm, dg, pen, seq

Where:
    dir = FWD or REV.
    tm  = Melting temperature of the annealing/binding part of the primer (Celsius).
    ttm = The total melting temperature of the primer with added seq (Celsius).
    dg  = The minimum free energy of the primer's secondary structure (kcal/mol).
    pen = The primer's penalty score. Lower is better.
    seq = The sequence of the primer in the 5' to the 3' direction.

positional arguments:
  SEQ          DNA sequence

optional arguments:
  -h, --help   show this help message and exit
  -f SEQ       additional sequence to add to FWD primer (5' to 3')
  -fl INT INT  space separated min-max range for the length to add from '-f' (5' to 3')
  -r SEQ       additional sequence to add to REV primer (5' to 3')
  -rl INT INT  space separated min-max range for the length to add from '-r' (5' to 3')
  -t SEQ       sequence to check for offtargets binding sites
  --version    show program's version number and exit

Algorithm

Creating and choosing primers for PCR is non-trivial because it requires multi-objective optimization. Ideally pairs of primers for PCR amplification would have similar tms, GC ratios close to 0.5, high minimum free energies (dg), and a lack off-target binding sites. In primers, like Primer3, choosing amongst those sometimes competing goals is accomplished with a linear function that penalizes undesirable characteristics. The primer pair with the lowest combined penalty is created.

Scoring

The penalty for each possible primer, p, is calculated as:

PENALTY(p) =
    abs(p.tm - optimal_tm) * penalty_tm +     // penalize each deg of suboptimal melting temperature
    abs(p.gc - optimal_gc) * penalty_gc +     // penalize suboptimal GC ratios
    abs(len(p) - optimal_len) * penalty_len + // penalize each bp of suboptimal length
    abs(p.tm - p.pair.tm) * penalty_tm_diff + // penalize each deg of melting temperature diff between primers
    abs(p.dg) * penalty_dg +                  // penalize each kcal/mol of free energy in secondary structure
    p.offtarget_count * penalty_offtarget     // penalize each off-target binding site

Each of the optimal (optimal_*) and penalty (penalty_*) parameters is adjustable through the primers.primers() function. The defaults are below.

optimal_tm: float = 62.0
optimal_gc: float = 0.5
optimal_len: int = 22
penalty_tm: float = 1.0
penalty_gc: float = 3.0
penalty_len: float = 1.0
penalty_tm_diff: float = 1.0
penalty_dg: float = 2.0
penalty_offtarget: float = 20.0

Off-target Binding Sites

Usually, off-target binding sites should be avoided. In primers, off-target binding sites are those with <= 1 mismatch in the last 10 bair pairs of the primer's 3' end. This definition experimentally supported by:

Wu, J. H., Hong, P. Y., & Liu, W. T. (2009). Quantitative effects of position and type of single mismatch on single base primer extension. Journal of microbiological methods, 77(3), 267-275

By default, primers are checked for off-targets within the seq parameter passed to primers.primers(seq). But the primers can be checked against another sequence if it is passed to the optional offtarget_check argument. This is useful when PCR'ing a subsequence of a larger DNA sequence like a plasmid.

seq = "AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA"
parent = "ggaattacgtAATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAAggaccagttacagga"

# primers are checked for offtargets in `parent`
fwd, rev = primers(seq, offtarget_check=parent)

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

primers-0.3.2.tar.gz (13.3 kB view hashes)

Uploaded Source

Built Distributions

primers-0.3.2-py3.11.egg (29.7 kB view hashes)

Uploaded Source

primers-0.3.2-py3-none-any.whl (13.4 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page