Bioinformatic python package.
Project description
This is a bioinformatic python package.
Install
pip install pybioinformatic --upgrade
Usage example
RNA secondary structure prediction.
from pybioinformatic import Nucleotide
# Generate random nucleic acid sequence.
random_nucl = Nucleotide.random_nucl(name='demo', length=[100, 150], bias=1.0)
# Secondary structure prediction
ss, mfe = random_nucl.predict_secondary_structure('test/structure.ps')
print(ss, mfe, sep='\n')
>demo length=135
CAAAAAAAAACCATAAGCCGCCATGTCTCACATCGCAACCGGCTCAAGTAGAGTGCCCCTAATAATATGATCTTCGCTACAGAAGTTCCCCCCCCGCTGCCGGCTAGATGCGAACTCCACGCCTGGATGGCTCAG
...............((((((((.((......(((((.(.((((...((((.................((.((((......)))).))........)))).)))).).))))).......)).))).)))))...
-27.299999237060547
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
pybioinformatic-0.0.2.tar.gz
(25.2 kB
view details)
Built Distribution
File details
Details for the file pybioinformatic-0.0.2.tar.gz
.
File metadata
- Download URL: pybioinformatic-0.0.2.tar.gz
- Upload date:
- Size: 25.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.8.19
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 265a6136956b1e2b9783422959826a88f38b8d144eab25012d511842fae7f1c0 |
|
MD5 | 4ae93cd9acc2d7a202ae488c5cdbbc60 |
|
BLAKE2b-256 | 02fe99e1725c14d36a05078b9c279c198f72bc611da96526ec4f046c698ed3ae |
File details
Details for the file pybioinformatic-0.0.2-py3-none-any.whl
.
File metadata
- Download URL: pybioinformatic-0.0.2-py3-none-any.whl
- Upload date:
- Size: 32.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.8.19
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | bd2eebc0dafd9a87fbb4e5337706c06cd455cf904551e39ba07888f40667e4e4 |
|
MD5 | 5b92f8bf720e1a5b4495ab10538c1fae |
|
BLAKE2b-256 | 4d75e135aefadc595c71be519f105d6460a53ec1a1d4bda0e3783927fe1480e6 |