Skip to main content

Bioinformatic python package.

Project description

This is a bioinformatic python package.

Install

pip install pybioinformatic --upgrade

Usage example

from pybioinformatic import Nucleotide

# Generate random nucleic acid sequence.
random_nucl = Nucleotide.random_nucl(name='demo', length=[100, 150], bias=1.0)

# Secondary structure prediction
ss, mfe = random_nucl.predict_secondary_structure('test/structure.ps')
print(ss, mfe, sep='\n')
>demo length=135
CAAAAAAAAACCATAAGCCGCCATGTCTCACATCGCAACCGGCTCAAGTAGAGTGCCCCTAATAATATGATCTTCGCTACAGAAGTTCCCCCCCCGCTGCCGGCTAGATGCGAACTCCACGCCTGGATGGCTCAG
...............((((((((.((......(((((.(.((((...((((.................((.((((......)))).))........)))).)))).).))))).......)).))).)))))...
-27.299999237060547

image

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pybioinformatic-0.0.3.tar.gz (28.9 kB view details)

Uploaded Source

Built Distribution

pybioinformatic-0.0.3-py3-none-any.whl (37.3 kB view details)

Uploaded Python 3

File details

Details for the file pybioinformatic-0.0.3.tar.gz.

File metadata

  • Download URL: pybioinformatic-0.0.3.tar.gz
  • Upload date:
  • Size: 28.9 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.8.19

File hashes

Hashes for pybioinformatic-0.0.3.tar.gz
Algorithm Hash digest
SHA256 6a0b016414f4be631f887275dfa6aedeedaa77504418c7216fa9b550c40e7c86
MD5 536a73fe09c3e54f3179721e45ff9904
BLAKE2b-256 89a94abafef8997216590888635822081f5b77c56e177fa09fe229bac30656c1

See more details on using hashes here.

File details

Details for the file pybioinformatic-0.0.3-py3-none-any.whl.

File metadata

File hashes

Hashes for pybioinformatic-0.0.3-py3-none-any.whl
Algorithm Hash digest
SHA256 6841fa6d6720d41044c458f70bc1e6f615c1642757478fa177b39d92d14ea27e
MD5 52cf408674cbe30688bab63a3fc40b17
BLAKE2b-256 a58a09486f092875c45e5e5d575b532484c7cb4f0666e8206f5a3cb4a8c724a5

See more details on using hashes here.

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page