Bioinformatic python package.
Project description
This is a bioinformatic python package.
Install
pip install pybioinformatic --upgrade
Usage example
from pybioinformatic import Nucleotide
# Generate random nucleic acid sequence.
random_nucl = Nucleotide.random_nucl(name='demo', length=[100, 150], bias=1.0)
# Secondary structure prediction
ss, mfe = random_nucl.predict_secondary_structure('test/structure.ps')
print(ss, mfe, sep='\n')
>demo length=135
CAAAAAAAAACCATAAGCCGCCATGTCTCACATCGCAACCGGCTCAAGTAGAGTGCCCCTAATAATATGATCTTCGCTACAGAAGTTCCCCCCCCGCTGCCGGCTAGATGCGAACTCCACGCCTGGATGGCTCAG
...............((((((((.((......(((((.(.((((...((((.................((.((((......)))).))........)))).)))).).))))).......)).))).)))))...
-27.299999237060547
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
pybioinformatic-0.0.4.tar.gz
(29.2 kB
view details)
Built Distribution
File details
Details for the file pybioinformatic-0.0.4.tar.gz
.
File metadata
- Download URL: pybioinformatic-0.0.4.tar.gz
- Upload date:
- Size: 29.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.8.19
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | a5091f925a4d7eb67f196af6083e4624300c0fde581705e2bc8d71bc21b2ae02 |
|
MD5 | 19e79e88018083aea3f9380ffc3c6c6a |
|
BLAKE2b-256 | adb1a17e635c10ee835f6897e38b8b4117d1bf0975bc3d610f7000bfc632806f |
File details
Details for the file pybioinformatic-0.0.4-py3-none-any.whl
.
File metadata
- Download URL: pybioinformatic-0.0.4-py3-none-any.whl
- Upload date:
- Size: 37.6 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.8.19
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 683a206231a4eb62ee6c02e8654437f6e4fcc9a8347cfca1494a0bb2ea386c17 |
|
MD5 | a0f28502c5c597ad8272b2f35631706f |
|
BLAKE2b-256 | 37a4cd033bcad124e06fe6b700d2ab5f8c2e06ae8891b78d924d35cfe477d18b |