Skip to main content

Bioinformatic python package.

Project description

This is a bioinformatic python package.

Install

pip install pybioinformatic --upgrade

Usage example

from pybioinformatic import Nucleotide

# Generate random nucleic acid sequence.
random_nucl = Nucleotide.random_nucl(name='demo', length=[100, 150], bias=1.0)

# Secondary structure prediction
ss, mfe = random_nucl.predict_secondary_structure('test/structure.ps')
print(ss, mfe, sep='\n')
>demo length=135
CAAAAAAAAACCATAAGCCGCCATGTCTCACATCGCAACCGGCTCAAGTAGAGTGCCCCTAATAATATGATCTTCGCTACAGAAGTTCCCCCCCCGCTGCCGGCTAGATGCGAACTCCACGCCTGGATGGCTCAG
...............((((((((.((......(((((.(.((((...((((.................((.((((......)))).))........)))).)))).).))))).......)).))).)))))...
-27.299999237060547

image

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pybioinformatic-0.0.5.tar.gz (29.4 kB view details)

Uploaded Source

Built Distribution

pybioinformatic-0.0.5-py3-none-any.whl (37.8 kB view details)

Uploaded Python 3

File details

Details for the file pybioinformatic-0.0.5.tar.gz.

File metadata

  • Download URL: pybioinformatic-0.0.5.tar.gz
  • Upload date:
  • Size: 29.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.8.19

File hashes

Hashes for pybioinformatic-0.0.5.tar.gz
Algorithm Hash digest
SHA256 e944e6d681b88caa0b5edfd6c768081f89031ad74eaedcf37a151be6a5ec657b
MD5 4fadb76059b30bf46da22ce3d05ed6fa
BLAKE2b-256 fdad8cd4fa7ea7bcab49b9e24e06b1db222123ad182e6b5d85c0cb6b43c4e97f

See more details on using hashes here.

File details

Details for the file pybioinformatic-0.0.5-py3-none-any.whl.

File metadata

File hashes

Hashes for pybioinformatic-0.0.5-py3-none-any.whl
Algorithm Hash digest
SHA256 e0f6dd1115d83bba08a59e59ace5f3c779f0d42cc98091faa48b67ffde3735f4
MD5 1e6d873bd9ca366be59d63a2f039aea4
BLAKE2b-256 7fc1858346377064c349484c44485d2772a07e509551880513d77c4d82e2ac6b

See more details on using hashes here.

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page