pyfaidx: efficient pythonic random access to fasta subsequences
Project description
Description
Samtools provides a function “faidx” (FAsta InDeX), which creates a small flat index file “.fai” allowing for fast random access to any subsequence in the indexed FASTA file, while loading a minimal amount of the file in to memory. This python module implements pure Python classes for indexing, retrieval, and in-place modification of FASTA files.
A manuscript is currently under preparation.
Installation
This package is tested under Linux, MacOS, and Windows using Python 3.2-3.4, 2.7, 2.6, and pypy.
pip install pyfaidx or python setup.py install
Usage
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta") # set strict_bounds=True for bounds checking
Acts like a dictionary.
>>> genes.keys() ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')
>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG
>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'
>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1'
>>> genes['NM_001282543.1'][200:230].start
201
>>> genes['NM_001282543.1'][200:230].end
230
>>> genes['NM_001282543.1'][200:230].longname
'NM_001282543.1:201-230'
>>> len(genes['NM_001282543.1'])
5466
Indexes like a list:
>>> genes[0][:50]
>AB821309.1:1-50
ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC
Slices just like a string:
>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC
>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA
>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........
Start and end coordinates are 0-based, just like Python.
Sequence can be buffered in memory using a read-ahead buffer for fast sequential access:
>>> from timeit import timeit
>>> fetch = "genes['NM_001282543.1'][200:230]"
>>> read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)"
>>> no_read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')"
>>> string_slicing = "genes = {}; genes['NM_001282543.1'] = 'N'*10000"
>>> timeit(fetch, no_read_ahead, number=10000)
0.2204863309962093
>>> timeit(fetch, read_ahead, number=10000)
0.1121859749982832
>>> timeit(fetch, string_slicing, number=10000)
0.0033553699977346696
Read-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.
Complements and reverse complements just like DNA
>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC
>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG
Custom key functions provide cleaner access:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT
Or just get a Python string:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
>>> genes
Fasta("tests/data/genes.fasta", as_raw=True)
>>> genes['NM_001282543.1'][200:230]
CTCGTTCCGCGCCCGCCATGGAACCGGATG
You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> for line in genes['NM_001282543.1']:
... print(line)
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
...
If you want to modify the contents of your FASTA file in-place, you can use the mutable argument. Any portion of the FastaRecord can be replaced with an equivalent-length string. Warning: This will change the contents of your file immediately and permanently:
>>> genes = Fasta('tests/data/genes.fasta', mutable=True)
>>> type(genes['NM_001282543.1'])
<class 'pyfaidx.MutableFastaRecord'>
>>> genes['NM_001282543.1'][:10]
>NM_001282543.1:1-10
CCCCGCCCCT
>>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
>>> genes['NM_001282543.1'][:15]
>NM_001282543.1:1-15
NNNNNNNNNNCTGGC
It also provides a command-line script:
cli script: faidx
For usage type faidx -h.
$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1:201-210
CTCGTTCCGC
>NM_001282543.1:300-320
GTAATTGTGTAAGTGACTGCA
$ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
CTCGTTCCGC
GTAATTGTGTAAGTGACTGCA
$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:201-210 (complement)
GAGCAAGGCG
$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:210-201
CGCCTTGCTC
$ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:210-201 (complement)
GCGGAACGAG
$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1:1-5466
CCCCGCCCCT........
..................
..................
..................
$ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480
>NM_001282543.1:5460-5480
AAAAAAANNNNNNNNNNNNNN
$ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480
>NM_001282543.1:5460-5480
AAAAAAAQQQQQQQQQQQQQQ
$ faidx tests/data/genes.fasta --bed regions.bed
...
$ faidx --stats tests/data/genes.fasta
AB821309.1 3510
KF435150.1 481
KF435149.1 642
NR_104216.1 4573
NR_104215.1 5317
NR_104212.1 5374
NM_001282545.1 4170
NM_001282543.1 5466
NM_000465.3 5523
NM_001282549.1 3984
NM_001282548.1 4113
XM_005249645.1 2752
XM_005249644.1 3004
XM_005249643.1 3109
XM_005249642.1 3097
XM_005265508.1 2794
XM_005265507.1 2848
XR_241081.1 1009
XR_241080.1 4884
XR_241079.1 2819
$ faidx --split-files tests/data/genes.fasta
$ ls
AB821309.1.fasta NM_001282549.1.fasta XM_005249645.1.fasta
KF435149.1.fasta NR_104212.1.fasta XM_005265507.1.fasta
KF435150.1.fasta NR_104215.1.fasta XM_005265508.1.fasta
NM_000465.3.fasta NR_104216.1.fasta XR_241079.1.fasta
NM_001282543.1.fasta XM_005249642.1.fasta XR_241080.1.fasta
NM_001282545.1.fasta XM_005249643.1.fasta XR_241081.1.fasta
NM_001282548.1.fasta XM_005249644.1.fasta
$ faidx --delimiter='_' tests/data/genes.fasta 000465.3
>000465.3
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
.......
Similar syntax as samtools faidx
A lower-level Faidx class is also available:
>>> from pyfaidx import Faidx
>>> fa = Faidx('genes.fa') # can return str with as_raw=True
>>> fa.index
OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])
>>> fa.index['AB821309.1'].rlen
3510
fa.fetch('AB821309.1', 1, 10) # these are 1-based genomic coordinates
>AB821309.1:1-10
ATGGTCAGCT
If the FASTA file is not indexed, when Faidx is initialized the build_index method will automatically run, and the index will be written to “filename.fa.fai” with write_fai(). where “filename.fa” is the original FASTA file.
Start and end coordinates are 1-based.
Changes
New in version 0.3.4:
–delimiter option for cli script and split_char argument for Fasta and Faidx
New in version 0.3.3:
–split-files option writes each returned sequence to an individual file. Names are generated based on the sequence name and region coordinates.
–stats option prints the name and sequence length for each entry, suitable for use as a UCSC-style [chrom.sizes](http://genome.ucsc.edu/goldenpath/help/hg19.chrom.sizes) file.
Sequence longname attribute allows access to “chr:start-end (complement)” formatted names
New in version 0.3.2:
Fasta __getitem__ no longer initializes new FastaRecord classes
Faidx read_ahead attribute implementaion avoids unnecessary disk hits (#34)
New in version 0.3.1:
Fasta can now accept an integer index in addition to string keys.
New in version 0.3.0:
FastaRecord now works as a line-based iterator (#30)
Added MutableFastaRecord class that allows same-length in-place replacement for FASTA (#29)
New in version 0.2.9:
Added read-ahead buffer for fast sequential sequence access (#26)
Fixed a condition where as_raw parameter was not respected (#27)
New in version 0.2.8:
Small internal refactoring
New in version 0.2.7:
Faidx and Fasta strict_bounds bounds checking logic is more correct
Fasta default-seq parameter now works
CLI script faidx now takes a BED file for fetching regions from a fasta
New in version 0.2.6:
Faidx no longer has raw_index attribute or rebuild_index method (reduce memory footprint)
Faidx index memory usage decreased by 31-40%
.fai creation is streaming, performance increase for very large indices
Possible speed regression when performing many small queries using Fasta class
New in version 0.2.5:
Fasta and Faidx can take default-seq in addition to as_raw, key_function, and strict_bounds parameters.
Fixed issue #20
Faidx has attribute raw_index which is a list representing the fai file.
Faidx has rebuild_index and write_fai functions for building and writing raw_index to file.
Extra test cases, and test cases against Biopython SeqIO
New in version 0.2.4:
Faidx index order is stable and non-random
New in version 0.2.3:
Fixed a bug affecting Python 2.6
New in version 0.2.2:
Fasta can receive the strict_bounds argument
New in version 0.2.1:
FastaRecord str attribute returns a string
Fasta is now an iterator
New in version 0.2.0:
as_raw keyword arg for Faidx and Fasta allows a simple string return type
__str__ method for FastaRecord returns entire contig sequence
New in version 0.1.9:
line wrapping of faidx is set based on the wrapping of the indexed fasta file
added --reverse and --complement arguments to faidx
New in version 0.1.8:
key_function keyword argument to Fasta allows lookup based on function output
Acknowledgements
This project is freely licensed by the author, Matthew Shirley, and was completed under the mentorship and financial support of Drs. Sarah Wheelan and Vasan Yegnasubramanian at the Sidney Kimmel Comprehensive Cancer Center in the Department of Oncology.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.