fast, memory-efficient, pythonic access to fasta sequence files
Project description
- Email:
- License:
MIT
Implementation
Requires Python >= 2.5. Stores a flattened version of the fasta file without spaces or headers and uses either a mmap of numpy binary format or fseek/fread so the sequence data is never read into memory. Saves a pickle (.gdx) of the start, stop (for fseek/mmap) locations of each header in the fasta file for internal use.
Usage
>>> from pyfasta import Fasta >>> f = Fasta('tests/data/three_chrs.fasta') >>> sorted(f.keys()) ['chr1', 'chr2', 'chr3'] >>> f['chr1'] NpyFastaRecord(0..80)
Slicing
>>> f['chr1'][:10] 'ACTGACTGAC' # get the 1st basepair in every codon (it's python yo) >>> f['chr1'][::3] 'AGTCAGTCAGTCAGTCAGTCAGTCAGT' # can query by a 'feature' dictionary >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9}) 'CTGACTGA' # same as: >>> f['chr1'][1:9] 'CTGACTGA' # with reverse complement (automatic for - strand) >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9, 'strand': '-'}) 'TCAGTCAG'
Numpy
The default is to use a memmaped numpy array as the backend. In which case it’s possible to get back an array directly…
>>> f['chr1'].tostring = False >>> f['chr1'][:10] # doctest: +NORMALIZE_WHITESPACE memmap(['A', 'C', 'T', 'G', 'A', 'C', 'T', 'G', 'A', 'C'], dtype='|S1') >>> import numpy as np >>> a = np.array(f['chr2']) >>> a.shape[0] == len(f['chr2']) True >>> a[10:14] # doctest: +NORMALIZE_WHITESPACE array(['A', 'A', 'A', 'A'], dtype='|S1')
mask a sub-sequence
>>> a[11:13] = np.array('N', dtype='c') >>> a[10:14].tostring() 'ANNA'
Backends (Record class)
It’s also possible to specify another record class as the underlying work-horse for slicing and reading. Currently, there’s just the default:
NpyFastaRecord which uses numpy memmap
FastaRecord, which uses using fseek/fread
MemoryRecord which reads everything into memory and must reparse the original fasta every time.
TCRecord which is identical to NpyFastaRecord except that it saves the index in a TokyoCabinet hash database, for cases when there are enough records that loading the entire index from a pickle into memory is unwise. (NOTE: that the sequence is not loaded into memory in either case).
It’s possible to specify the class used with the record_class kwarg to the Fasta constructor:
>>> from pyfasta import FastaRecord # default is NpyFastaRecord >>> f = Fasta('tests/data/three_chrs.fasta', record_class=FastaRecord) >>> f['chr1'] FastaRecord('tests/data/three_chrs.fasta.flat', 0..80)
other than the repr, it should behave exactly like the Npy record class backend
it’s possible to create your own using a sub-class of FastaRecord. see the source in pyfasta/records.py for details.
Command Line Interface
there’s also a command line interface to manipulate / view fasta files. the pyfasta executable is installed via setuptools, running it will show help text.
split a fasta file into 6 new files of relatively even size:
$ pyfasta split -n 6 original.fasta
create 1 new fasta file with the sequence split into 10K-mers:
$ pyfasta split -n 1 -k 10000 original.fasta
2 new fasta files with the sequence split into 10K-mers with 2K overlap:
$ pyfasta split -n 2 -k 10000 -o 2000 original.fasta
show some info about the file (and show gc content):
$ pyfasta info –gc test/data/three_chrs.fasta
extract sequence from the file. use the header flag to make a new fasta file. the args are a list of sequences to extract.
$ pyfasta extract –header –fasta test/data/three_chrs.fasta seqa seqb seqc
cleanup
(though for real use these will remain for faster access)
>>> import os >>> os.unlink('tests/data/three_chrs.fasta.gdx') >>> os.unlink('tests/data/three_chrs.fasta.flat')
Testing
there is currently > 99% test coverage for the 2 modules and all included record classes. to run the tests:
$ python setup.py nosetests
Changes
0.3.3
include this file in the tar ball (thanks wen h.)
0.3.2
separate out backends into records.py
use nosetests (python setup.py nosetests)
add a TCRecord backend for next-gen sequencing availabe if tc is (easy-)installed.
improve test coverage.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.