QUEEN (a Python module to universally program, QUinE, and Edit Nucleotide sequences)
Project description
QUEEN Installation and User Manual
QUEEN (a framework to generate quinable and efficiently editable nucleotide sequence resources) is a Python programming module designed to describe, share credit DNA building processes and resources. DNA parts information can be imported from external annotated DNA files (GenBank and FASTA format). Output file (GenBank format) encodes the complete information of the constructed DNA and its annotations and enables the production of a quine code that self-reproduces the output file itself. In QUEEN, all of the manipulations required in DNA construction are covered by four simple operational functions, "cutdna", "modifyends", "flipdna", and "joindna" that can collectively represent any of the standard molecular DNA cloning processes, two search functions, "searchsequence" and "searchfeature", and two super functions, "editsequence" and "editfeature". A new DNA can be designed by programming a Python script or using Jupyter Notebook, an interactive Python programming interpreter. The designed DNA product can be output in the GenBank file format that involves the history of its building process. The "quinable" feature of a QUEEN-generated GenBank file certifies that the annotated DNA material information and its production process are fully transparent, reproducible, inheritable, and modifiable by the community.
- Software dependency
- Installation
- Usage
- QUEEN class
- Output functions
- Search Function
- Operational functions
- Common parameters of the quinable functions
- Quine
- Visualization
Software dependency
Python 3.7.0 or later
Installation
-
Install QUEEN using the following command.
pip3 install git+https://github.com/yachielab/QUEEN.git -
Install Graphviz (optional; required for visualizing flowcharts of DNA building processes using the
visualizeflow()function described below). Graphviz package is available at the following link.
Usage
QUEEN provides the QUEEN class to define a double-stranded (ds)DNA object with sequence annotations. The QUEEN class and its operational functions are described below. Jupyter Notebook files for all of the example codes are provided in ./demo/tutorial of QUEEN (https://github.com/yachielab/QUEEN) and also made executable in Google Colaboratory:
- https://colab.research.google.com/drive/1ubN0O8SKXUr2t0pecu3I6Co8ctjTp0PS?usp=sharing
- https://colab.research.google.com/drive/1dPcNhsOl2sne_wq7ZULXXFUxizR6JQrR?usp=sharing
QUEEN class
The QUEEN class can define a dsDNA object with sequence annotations. It can be created by specifying a DNA sequence or importing a sequence data file in GenBank or FASTA file format (single sequence entry). When a GenBank format file is imported, its NCBI accession number, Addgene plasmid ID, or Benchling share link can be provided instead of downloading the file to your local environment.
Example code 1: Create a QUEEN class object (blunt-ends)
A QUEEN_object (blunt-end) is created by providing its top-stranded sequence (5’-to-3’). By default, the DNA topology will be linear.
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCGTCGA")
Example code 2: Create a QUEEN class object (sticky-end)
The left and right values separated by "/" show the top and bottom strand sequences of the generating QUEEN_object, respectively. The top strand sequence is provided in the 5’-to-3’ direction from left to right, whereas the bottom strand sequence is provided in the 3′-to-5′ direction from left to right. Single-stranded regions can be provided by "-" for the corresponding nucleotide positions on the opposite strands. A:T and G:C base-pairing rule is required between the two strings except for the single-stranded positions.
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCG----/----ATACGCAGCT")
Example code 3: Create a circular QUEEN class object
The sequence topology of generating QUEEN_object can be specified by "linear" or "circular".
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCGTCGA", topology="circular")
Example code 4.1: Create a QUEEN class object from a GenBank file in a local directory
GenBank file can be loaded by specifying its local file path.
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
pUC19 = QUEEN(record="./input/pUC19.gbk")
Example code 4.2: Create a QUEEN class object using a NCBI accession number
QUEEN_object can be generated from a NCBI accession number with dbtype="ncbi".
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
#"M77789.2" is NCBI accession number for pUC19 plasmid
pUC19 = QUEEN(record="M77789.2", dbtype="ncbi")
Example code 4.3: Create a QUEEN class object using an Addgene plasmid ID
QUEEN_object can be generated from an Addgene plasmid ID with dbtype="addgene".
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
#"50005" is Addgene plasmid ID for pUC19 plasmid
pUC19 = QUEEN(record="50005", dbtype="addgene")
Example code 4.4: Create a QUEEN class object from a Benchling share link
QUEEN_object can be generated from a Benchling shared link with dbtype="benchling".
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
plasmid = QUEEN(record="https://benchling.com/s/seq-U4pePb09KHutQzjyOPQV", dbtype="benchling")
pX330 plasmid encoding a Cas9 gene and a gRNA expression unit is provided in the above example. The QUEEN_object generated here is used in the following example codes in this document.
Properties of QUEEN class objects
-
.project:
str
Project name ofQUEEN_objectconstruction. In QUEEN, this property is also used as a dictionary key to access the.productdictdescribed below. If aQUEEN_objectis created from a GenBank or FASTA file, its sequence ID will be inherited here. Otherwise, the project name is automatically generated to be unique amongst the existing.productdictkeys. -
.seq:
str
Top strand sequence (5′→3′). This property cannot be directly edited; only the built-in operational functions of QUEEN described below can edit this property. -
.rcseq:
str
Bottom strand sequence (5′→3′). This property cannot be directly edited; only the built-in operational functions of QUEEN described below can edit this property. -
.topology:
str("linear"or"circular")
Sequence topology. When aQUEEN_objectis created by loading from a GenBank file, the topology is set according to the description in the GenBank file. Only the built-in operational functions of QUEEN described below can edit this property. -
.dnafeatures:
listofDNAfeature_objects
When aQUEEN_objectis loaded from a GenBank file,.dnafeatureswill automatically be generated from the GenBank file's sequence features. Otherwise,.dnafeatureswill be an empty list. EachDNAfeature_objectwith the following attributes provides an annotation for a given range of DNA sequence in aQUEEN_object.- .feature_id:
str
Unique identifier. It is automatically determined to each feature when aQUEEN_objectis loaded from a GenBank file. - .feature_type:
str
Biological nature. Any value is acceptable. The GenBank format requires registering a biological nature for each feature. - .start:
int
Start position ofDNAfeature_objectinQUEEN_object. - .end:
int
Start position ofDNAfeature_objectinQUEEN_object. - .strand:
int (1 or -1)
Direction ofDNAfeature_objectinQUEEN_object. Top strand (1) or bottom strand (-1). - .sequence:
str
Sequence of theDNAfeature_objectfor its encoded direction. - .qualifiers:
dict
Qualifiers. When a GenBank file is imported, qualifiers of each feature will be registered here. Qualifier names and values will serve as dictionary keys and values, respectively.
DNAfeature_objectcan be edited only by theeditfeature()function described below. DNAfeature class is implemented as a subclass of the Biopython SeqFeature class. Therefore, apart from the above attributes, DNAfeature class inherits all the attributes and methods of SeqFeature class. For details about SeqFeature class, see (https://biopython.org/docs/dev/api/Bio.SeqFeature.html) - .feature_id:
-
.productdict:
dict
Dictionary for all of the inheritedQUEEN_objectsused to construct the presentQUEEN_object. The.projectof eachQUEEN_objectserves as a key of this dictionary.
Output functions
QUEEN_objects hold a simple set of functions to output its information.
-
.printsequence(start=int, end=int, strand=int, display=bool, hide_middle=int, linebreak=int)Returns and displays partial or the entire dsDNA sequence and sequence end structures of
QUEEN_object.Parameters
- start:
int(zero-based indexing; default:0)
Start position of the sequence. - end:
int(zero-based indexing; default: the last sequence position ofQUEEN_object)
End position of the sequence. - strand:
int:1(top strand only),-1(bottom strand only), or2(both strands) (default:2)
Sequence strand(s) to be returned. - display:
bool(TrueorFalse; default:True)
IfTrue, the output will be displayed inSTDOUT. - hide_middle:
intorNone(default:None)
Length of both end sequences to be displayed. - linebreak:
int(default: length of theQUEEN_objectsequence)
Length of sequence for linebreak.
Return
If
strandis1or-1, sequence of the defined strand (5’→3’)
Ifstrandis2,"str/str": "top strand sequence (5’→3’)/bottom strand sequence (3’→5’)"Example code 5: Print a dsDNA object
(Expected runtime: less than 1 sec.)
Source code
from queen import * fragment **=** QUEEN(seq**=**"CCGGTATGCG----/----ATACGCAGCT") fragment.printsequence(display=True)
Output
5′ CCGGTATGCG---- 3′ 3′ ----ATACGCAGCT 5′ - start:
-
.printfeature(feature_list=list, attribute=list, seq=bool, separation=str, output=str, x_based_index=int)Print a tidy data table of annotation features/attributes of
QUEEN_object. Default output attributes are"feature_id","feature_type","qualifiers:label","start","end", and"strand".Parameters
- feature_list:
listofDNAfeaure_objects(default:.dnafeatures)
List of features to be displayed in the output table. If not given, all features held by the QUEEN_object will be the subject. - attribute:
listof feature attributes (default:["feature_id", "feature_type", "qualifiers:label", "start", "end", "strand"]) List of feature attributes to be displayed in the output table. If the value is"all", it will generate a table for all the attributes held by theQUEEN_objectexcept for"sequence". - seq:
bool(TrueorFalse; default:False)
IfTrue, the sequence of each feature for its encoded direction will be displayed in the output table. - separation:
str(default: space(s) to generate a well-formatted table)
String to separate values of each line. - output:
str(default:STDOUT)
Output file name. - x_based_index:
0or1(default:0)
As a default, positions of all features are given in the zero-based indexing in QUEEN (same as Python). If this parameter is set to1, they will be shown in the 1-based indexing (as seen in the GenBank format).
Return
NoneExample code 6: Print DNA features in a well-formatted table
(Expected runtime: less than 1 sec.)
Source code
from queen import * plasmid = QUEEN(record="input/px330.gb") plasmid.printfeature()
Output
feature_id feature_type qualifier:label start end strand 1 source source 0 8484 + 100 primer_bind hU6-F 0 21 + 200 promoter U6 promoter 0 241 + 300 primer_bind LKO.1 5' 171 191 + 400 misc_RNA gRNA scaffold 267 343 + 500 enhancer CMV enhancer 439 725 + 600 intron hybrid intron 983 1211 + 700 regulatory Kozak sequence 1222 1232 + 800 CDS 3xFLAG 1231 1297 + 900 CDS SV40 NLS 1303 1324 + 1000 CDS Cas9 1348 5449 + 1100 CDS nucleoplasmin NLS 5449 5497 + 1200 primer_bind BGH-rev 5524 5542 - 1300 polyA_signal bGH poly(A) signal 5530 5738 + 1400 repeat_region AAV2 ITR 5746 5876 + 1500 repeat_region AAV2 ITR 5746 5887 + 1600 rep_origin f1 ori 5961 6417 + 1700 primer_bind F1ori-R 6048 6068 - 1800 primer_bind F1ori-F 6258 6280 + 1900 primer_bind pRS-marker 6433 6453 - 2000 primer_bind pGEX 3' 6552 6575 + 2100 primer_bind pBRforEco 6612 6631 - 2200 promoter AmpR promoter 6698 6803 + 2300 CDS AmpR 6803 7664 + 2400 primer_bind Amp-R 7021 7041 - 2500 rep_origin ori 7834 8423 + 2600 primer_bind pBR322ori-F 8323 8343 + - feature_list:
-
.outputgbk(output=str)Output
QUEEN_objectto a GenBank file. In addition to all of theDNAfeature_objectsin the inputQUEEN_object, aDNAfeature_objectencoding the entire construction processes that generated theQUEEN_objectinqualifiers:building_historywill also be output to the GenBank file.Parameter
- output: str (default: STDOUT) Output file name.
Return
None
Search Function
QUEEN_objects hold .searchsequene() and .searchfeature() functions that enables users to search for query sequences and values in DNAfeature_objects.
-
.searchsequence (query=regex or str, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")Search for specific sequences from a user-defined region of a
QUEEN_objectand return a list ofDNAfeature_objects. Start and end attributes of returnedDNAfeature_objectsrepresent the sequence regions of theQUEEN_objectthat matched the user's query. Note that the returnedDNAfeature_objectswill not be generated with.feature_idand reflected to the parentalQUEEN_object**. **The returnedDNAfeature_objectscan be added toQUEEN_object.dnafeaturesbyeditfeature()with thecreateattributeoption as explained below.Parameters
- query:
regexorstr(default:".+")
Search query sequence. If the value is not provided, the user-specified search region of theQUEEN_objectsequence withstartandendexplained below will be returned. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. All IUPAC nucleotide symbols can be used. Restriction enzyme cut motif representation can be used to define a query with"^"and"_"or"(int/int)". For example, EcoRI cut motif can be provided by"G^AATT_C", where"^"and"_"represent the cut positions on the top and bottom strands, respectively, or by"GAATTC(-5/-1)"or"(-5/-1)GAATTC", where the left and right integers between the parentheses represent the cut positions on the top and bottom strands, respectively. Similarly, the cut motif of a Type-IIS restriction enzyme BsaI can be given by"GGTCTCN^NNN_N","N^NNN_NGAGACC","GGTCTC(1/5)"or"(5/1)GAGACC". The returnedDNAfeature_objectsobtained for a query restriction enzyme cut motif will hold the cutting rule in the"qualifiers:cutsite"attribute, which can be added toQUEEN_object.dnafeaturesbyeditfeature()with thecreateattributeoption as explained below. Regular expression is disabled for restriction enzyme cut motifs. - start:
int(zero-based indexing; default:0)
Start position of the target range of theQUEEN_objectsequence for the search. - end:
int(zero-based indexing; default: the last sequence position ofQUEEN_object)
End position of the target range of theQUEEN_objectsequence for the search. - strand:
int:1(top strand only),-1(bottom strand only), or2(both strands) (default:2)
Sequence strand to be searched.
Return
list(listofDNAfeature_objects)Example code 7: Search for a DNA sequence motif with regular expression
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
match_list = plasmid.searchsequence(query="G[ATGC]{19}GGG") plasmid.printfeature(match_list, seq=True, attribute=["start", "end", "strand"])
Output
start end strand sequence 115 138 + GTAGAAAGTAATAATTTCTTGGG 523 546 + GACTTTCCATTGACGTCAATGGG 816 839 + GTGCAGCGATGGGGGCGGGGGGG 1372 1395 + GACATCGGCACCAACTCTGTGGG 1818 1841 + GGCCCACATGATCAAGTTCCGGG 3097 3120 + GATCGGTTCAACGCCTCCCTGGG 3300 3323 + GCGGCGGAGATACACCGGCTGGG 3336 3359 + GAAGCTGATCAACGGCATCCGGG 3529 3552 + GGCAGCCCCGCCATTAAGAAGGG 3577 3600 + GACGAGCTCGTGAAAGTGATGGG ︙ 493 516 - GCGTTACTATTGACGTCAATGGG 654 677 - GTCCCATAAGGTCATGTACTGGG 758 781 - GGTGGGGAGGGGGGGGAGATGGG 1014 1037 - GCGCGAGGCGGCGGCGGAGCGGG 1301 1324 - GACCTTCCGCTTCTTCTTTGGGG 1820 1843 - GCCCCGGAACTTGATCATGTGGG 2090 2113 - GAAGTTGCTCTTGAAGTTGGGGG 2183 2206 - GGCGTACTGGTCGCCGATCTGGG 2288 2311 - GATCATAGAGGCGCTCAGGGGGG 2689 2712 - GCCAGAGGGCCCACGTAGTAGGG ︙Example code 8: Search for a DNA sequence motif with fuzzy matching
Search for
"AAAAAAAA"sequence, permitting a single nucleotide mismatch.
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
match_list = plasmid.searchsequence(query="(?:AAAAAAAA){s<=1}") plasmid.printfeature(match_list, seq=True)
Output
feature_id feature_type qualifiers:label start end strand sequence null misc_feature null 5484 5492 + AAAAAAGA null misc_feature null 6369 6377 + AACAAAAA null misc_feature null 7872 7880 + AAACAAAA null misc_feature null 346 354 - AAAACAAA null misc_feature null 799 807 - AAAAAATA null misc_feature null 1201 1209 - GAAAAAAA null misc_feature null 6716 6724 - AAAAATAA null misc_feature null 7844 7852 - AGAAAAAAExample code 9: Search for a DNA sequence with the IUPAC nucleotide code
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
match_list = plasmid.searchsequence(query="SWSWSWDSDSBHBRHH") plasmid.printfeature(match_list, seq=True)
Output
feature_id feature_type qualifiers:label start end strand sequence null misc_feature null 4098 4114 + GAGACAGCTGGTGGAA null misc_feature null 3550 3566 - CTGTCTGCAGGATGCC null misc_feature null 5239 5255 - CTCTGATGGGCTTATC null misc_feature null 6415 6431 - GAGAGTGCACCATAAA null misc_feature null 8357 8373 - GTCAGAGGTGGCGAAA - query:
-
.searchfeature(key_attribute=str, query=regex or str, source=list of DNAfeature_objects, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")Search for
DNAfeature_objectsholding a queried value in a designatedkey_attributeinQUEEN_object.Parameters
- key_attribute:
str(default:"all")
Attribute type to be searched (feature_id,feature_type,"qualifiers:*", orsequence). If the value is not provided, it will be applied to all of the attributes in theQUEEN_object, excludingsequence. However, if thequeryvalue is provided with only the four nucleotide letters (A, T, G, and C), this value will be automatically set tosequence. - query:
regexorstr(default:".+")
Query term.DNAfeature_objectsthat have a value matches to this query forkey_attributedesignated above will be returned. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. If thekey_attributeissequence, all IUPAC nucleotide symbols can be used. - source:
listof_DNAfeature_objects(default:QUEEN_object.dnafeatures)
SourceDNAfeature_objectsto be searched.DNAfeature_objectsoutside the search range defined bystart,end, andstrandwill be removed from the source. AnyDNAfeature_objectscan be provided here. For example, a list ofDNAfeature_objects_returned from anothersearchsequence()orsearchfeature()operation can be used as the source to achieve an AND search with multiple queries. - start:
int(zero-based indexing; default:0)
Start position of the target range of theQUEEN_objectsequence for the search. - end:
int(zero-based indexing; default: the last sequence position ofQUEEN_object)
End position of the target range of theQUEEN_objectsequence for the search. - strand:
int:1(top strand only),-1(bottom strand only), or2(both strands) (default:2)
Sequence strand to be searched.
Return
list(listofDNAfeature_objects)Example code 10: Search for sequence features having specific attribute values
Search for
DNAfeature_objectswith a feature type"primer_bind", and then further screen ones holding a specific string in"qualifiers:label".
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
feature_list = plasmid.searchfeature(key_attribute="feature_type", query="primer_bind") plasmid.printfeature(feature_list) sub_feature_list = plasmid.searchfeature(key_attribute="qualifier:label", query=".+-R$", source=feature_list) plasmid.printfeature(sub_feature_list)
Output
feature_id feature_type qualifiers:label start end strand 200 primer_bind hU6-F 0 21 + 300 primer_bind LKO.1 5' 171 191 + 1200 primer_bind BGH-rev 5524 5542 - 1700 primer_bind F1ori-R 6048 6068 - 1800 primer_bind F1ori-F 6258 6280 + 1900 primer_bind pRS-marker 6433 6453 - 2000 primer_bind pGEX 3' 6552 6575 + 2100 primer_bind pBRforEco 6612 6631 - 2400 primer_bind Amp-R 7021 7041 - 2600 primer_bind pBR322ori-F 8323 8343 + feature_id feature_type qualifiers:label start end strand 1700 primer_bind F1ori-R 6048 6068 - 2400 primer_bind Amp-R 7021 7041 - - key_attribute:
Operational functions
QUEEN objects can be manipulated by four simple operational functions, cutdna(), modifyends(), flipdna(), and joindna(), that can collectively represent any of the standard molecular DNA cloning processes, and two super functions, editsequence() and editfeature().
-
cutdna(input=QUEEN_object, *cutsites=*list of (int, "int/int", or DNAfeature_object), product=str, process_name=str, process_discription="str")Cut
QUEEN_objectat queried positions or by queriedDNAfeature_objectand return a list of fragmentedQUEEN_object. Each existingDNAfeature_objectin the originalQUEEN_objectwill be inherited to the generatingQUEEN_object. Suppose anyDNAfeature_objectsare at the cut boundaries being split into fragments. In that case, eachDNAfeature_objectwill also be carried over to the newQUEEN_objectwith the"qualifiers:broken_feature"attribute to be"[.project of the original QUEEN_object]:[.feature_id of the original DNAfeature_object]:[sequence length of the original DNAfeature_object]:[sequence of the original DNAfeature_object]:[start..end positions of the original DNAfeature_object in the sequence of the original QUEEN_object]:[5'..3' end positions of the broken DNAfeature_object in the original DNAfeature_object]". This function also linearizes a circularQUEEN_object.Parameters
- input:
QUEEN_object - cutsites:
listofint,"int/int", and/orDNAfeature_objects
List of cut positions. For blunt-end cut, a cut position can be provided byint. For sticky-end cut, a cut position can be specified by"int/int", where the left and right integers represent cut positions on the top and bottom strands, respectively.DNAfeature_objectsholding"qualifiers:cut_site"attributes can also be provided to cut a query DNA. This operation cannot proceed with multiple cut sites where a nicking or blunt-end cut of a cutting event happens between two nick positions of another sticky-end cut.
Valid case:
cutdna(object, *["100/105", "120/110", "50/55"])
Invalid case:cutdna(object, *["50/105", "100/55", "120/110"])Return
list(listofQUEEN_objects)Example code 11: Cut pX330 plasmid at multiple positions
Cut a circular plasmid px330 at the three different positions, resulting in the generation of three fragments. Then, cut one of the three fragments again.
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
print(plasmid) fragments = cutdna(plasmid ,1000, 2000, 4000) print(fragments) fragment3, fragment4 = cutdna(fragments[1], 500) print(fragment3) print(fragment4)
Output
<queen.QUEEN object; project='pX330', length='1000 bp', topology='linear' >, <queen.QUEEN object; project='pX330', length='2000 bp', topology='linear' >, <queen.QUEEN object; project='pX330', length='5484 bp', topology='linear' >] <queen.QUEEN object; project='pX330', length='500 bp', topology='linear' > <queen.QUEEN object; project='pX330', length='1500 bp', topology='linear' >If an invalid cut pattern are provided, an error message will be returned.
Source code (continued from the previous code)
fragments = cutdna(plasmid, *["50/105", "100/55", "120/110"])
Error message
ValueError: Invalid cut pattern.
Example code 12: Digest pX330 plasmid by EcoRI
Digestion of pX330 plasmid with EcoRI can be simulated as follows.
- Search for EcoRI recognition sites in pX330 with its cut motif and obtain the
DNAfeature_objectsrepresenting its cut position(s) and motif. - Use the
DNAfeature_objectsto cut pX330 bycutdna().
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
sites = plasmid.searchsequence("G^AATT_C") fragments = cutdna(plasmid, *sites) for fragment in fragments: print(fragment) fragment.printsequence(display=True, hide_middle=10)
Output
<queen.QUEEN object; project='pX330', length='8488 bp', topology='linear' > 5' AATTCCTAGA...AGTAAG---- 3' 3' ----GGATCT...TCATTCTTAA 5'QUEEN provides a library of restriction enzyme motifs (described in the New England Biolab's website).
Source code (continued from the previous code)
from QUEEN import cutsite #Import a restriction enzyme library sites = plasmid.searchsequence(cutsite.lib["EcoRI"]) fragments = cutdna(plasmid, *sites) for fragment in fragments: print(fragment) fragment.printsequence(display=True, hide_middle=10)
Output
<queen.QUEEN object; project='pX330', length='8488 bp', topology='linear' > 5' AATTCCTAGA...AGTAAG---- 3' 3' ----GGATCT...TCATTCTTAA 5'Example code 13: Digest pX330 plasmid by Type-IIS restriction enzyme BbsI
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
sites = plasmid.searchsequence("GAAGAC(2/6)") fragments = cutdna(plasmid,*sites) for fragment in fragments: print(fragment) fragment.printsequence(display=True, hide_middle=10)
Output
<queen.QUEEN object; project='pX330', length='8466 bp', topology='linear' > 5' GTTTTAGAGC...ACGAAA---- 3' 3' ----ATCTCG...TGCTTTGTGG 5' <queen.QUEEN object; project='pX330', length='26 bp', sequence='CACCGGGTCTTCGAGAAGACCTGTTT', topology='linear'> 5' CACCGGGTCT...AGACCT---- 3' 3' ----CCCAGA...TCTGGACAAA 5'Here, the BbsI recognition motif can also be represented by
"(6/2)GTCTTC","GAAGACNN^NNNN_"or"^NNNN_NNGTCTTC". The BbsI recognition motif is also available from the library of restriction enzyme motifs.Source code (continued from the previous code)
from QUEEN import cutsite #Import a restriction enzyme library sites = plasmid.searchsequence(cutsite.lib["BbsI"]) fragments = cutdna(plasmid, *sites) for fragment in fragments: print(fragment) fragment.printsequence(display=True, hide_middle=10)
Output
<queen.QUEEN object; project='pX330', length='8466 bp', topology='linear' > 5' GTTTTAGAGC...ACGAAA---- 3' 3' ----ATCTCG...TGCTTTGTGG 5' <queen.QUEEN object; project='pX330', length='26 bp', sequence='CACCGGGTCTTCGAGAAGACCTGTTT', topology='linear'> 5' CACCGGGTCT...AGACCT---- 3' 3' ----CCCAGA...TCTGGACAAA 5' - input:
-
cropdna(input=QUEEN_object, start=int, "int/int", or DNAfeature_object, end=int, "int/int", or DNAfeature_object, product=str, process_name=str, process_description="str")This is a subfunction of
cutdna()and extracts a partial fragment fromQUEEN_object.Parameters
- input:
QUEEN_object - start:
int,"int/int"(zero-based indexing) orDNAfeature_object(default:0)
Start position of the fragment of theQUEEN_objectsequence to be trimmed. - end:
int,"int/int"(zero-based indexing)orDNAfeature_object (default: the last sequence position ofQUEEN_object)
End position of the fragment of theQUEEN_objectsequence to be trimmed. If the topology of theQUEEN_objectis"linear", the end position must be larger than thestartposition. If the topology is"circular"and thestartposition is larger than theendposition, the fragment across the zero position will be returned.
Return
QUEEN_objectExample code 14: Crop a sequence fragment within a specified region
If the second fragment of "Example code 11" is for further manipulation,
cropdna()is convenient.
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
fragment = cropdna(plasmid ,2000, 4000) print(fragment)
Output
<queen.QUEEN object; project='pX330', length='2000 bp', topology='linear' >If a start position is larger than an end position, an error message will be returned.
Source code (continued from the previous code)
fragment = cropdna(fragment, 1500, 1000)
Error message
ValueError: 'end' position must be larger than 'start' position.
- input:
-
modifyends(input=QUEEN_object, left="str/str", right="str/str", product=str, process_name=str, process_description="str")Modify sequence end structures of
QUEEN_object. If the topology is"circular", it won't work.Parameters
- input:
QUEEN_object - left:
"str","str/str"(default:None)
Left sequence end structure ofQUEEN_object. The following examples show how to provide this parameter. - right:
"str","str/str"(default:None)
Right sequence end structure ofQUEEN_object. The following examples show how to describe the parameter.
Return
QUEEN_objectExample code 15: Trim nucleotides from a blunt-ended dsDNA to generate a sticky-ended dsDNA
Sticky ends can be generated by trimming nucleotides where their end structures are given by top and bottom strand strings with
"*"and"-"separated by"/", respectively. The letters"-"indicate nucleotide letters to be trimmed, and the letters"*"indicate ones to remain.
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
fragment = cropdna(plasmid, 100, 120) fragment.printsequence(display=True) fragment = modifyends(fragment, "-----/*****", "**/--") fragment.printsequence(display=True)
Output
5' CTTAACGTTGGCTTGCCACG 3' 3' GAATTGCAACCGAACGGTGC 5' 5' ----ACGTTGGCTTGCCACG 3' 3' GAATTGCAACCGAACGGT-- 5'The following codes achieve the same manipulation.
Source code (continued from the previous code)fragment = cropdna(plasmid,'105/100', '120/118') fragment.printsequence(display=True)
A regex-like format can also be used.
Source code (continued from the previous code)fragment = modifyends(fragment, "-{5}/*{5}","*{2}/-{2}") fragment.printsequence(display=True)
If a QUEEN object with circular topology is given, an error message will be returned.
Source code (continued from the previous code)fragment = modifyends(plasmid, "-----/*****", "**/--")
Error message
ValueError: End sequence structures cannot be modified. The topology of the QUEEN_object is circular.
Example code 16: Add adapter sequences
modifyends()can also add adapter sequences to DNA ends.
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
#Add blunt-ended dsDNA sequences to both ends fragment = cropdna(plasmid, 100, 120) fragment = modifyends(fragment,"TACATGC","TACGATG") fragment.printsequence(display=True) #Add sticky-ended dsDNA sequences to both ends fragment = cropdna(plasmid, 100, 120) fragment = modifyends(fragment,"---ATGC/ATGTACG","TACG---/ATGCTAC") fragment.printsequence(display=True)
Output
5' TACATGCTACAAAATACGTGACGTAGATACGATG 3' 3' ATGTACGATGTTTTATGCACTGCATCTATGCTAC 5' 5' ---ATGCTACAAAATACGTGACGTAGATACG--- 3' 3' ATGTACGATGTTTTATGCACTGCATCTATGCTAC 5' - input:
-
flipdna(input=QUEEN_object, product=str, process_name=str, process_description="str")Invert
QUEEN_object.Parameters
- input:
QUEEN_object
Return
QUEEN_object - input:
-
joindna(*inputs=*list of QUEEN objects, topology=str, product=str, process_name=str, process_description="str")Assemble
QUEEN_object. The connecting DNA end structures must be compatible (i.e., only blunt ends and compatible sticky ends can be assembled). If the assembly restores unfragmented sequences ofDNAfeature_objectsthat are fragmented before the assembly and hold"qualifiers:broken_feature"attributes, the originalDNAfeature_objectswill be restored in the outputQUEEN_object(the fragmentedDNAfeature_objectswill not be inherited). A single linearQUEEN_objectprocessed by this function will be circularized.Parameters
- inputs:
listofQUEEN_object - topology:
str("linear"or"circular"; default:"linear")
Topology of the outputQUEEN_object.
Return
QUEEN_objectExample code 17: Clone an EGFP fragment into pX330
- Generate a QUEEN class object for an EGFP fragment,
- Create EcoRI sites to both ends of the EGFP fragment,
- Digest the EGFP fragment and pX330 by EcoRI, and
- Assemble the EGFP fragment and linearized pX330.
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
EGFP = QUEEN(record="input/EGFP.fasta") EGFP = modifyends(EGFP, cutsite.lib["EcoRI"].seq, cutsite.lib["EcoRI"].seq) sites = EGFP.searchsequence(cutsite.lib["EcoRI"]) insert = cutdna(EGFP, *sites)[1] insert.printsequence(display=True, hide_middle=10) sites = plasmid.searchsequence(cutsite.lib["EcoRI"]) backbone = cutdna(plasmid, *sites)[0] backbone.printsequence(display=True, hide_middle=10) pEGFP = joindna(backbone, insert, topology="circular") print(plasmid) print(EGFP) print(pEGFP)
Output
5′ AATTCGGCAG...ACAAGG---- 3′ 3′ ----GCCGTC...TGTTCCTTAA 5′ 5′ AATTCCTAGA...AGTAAG---- 3′ 3′ ----GGATCT...TCATTCTTAA 5′ <queen.QUEEN object; project='pX330', length='8484 bp', topology='circular'> <queen.QUEEN object; project='EGFP', length='789 bp', topology='linear'> <queen.QUEEN object; project='pX330', length='9267 bp', topology='circular'>If connecting DNA end structures of the input
QUEEN_objectare not compatible, an error message will be returned.
Source code (continued from the previous codeEGFP = QUEEN(record="input/EGFP.fasta") EGFP = modifyends(EGFP, cutsite.lib["BamHI"].seq, cutsite.lib["BamHI"].seq) sites = EGFP.searchsequence(cutsite.lib["BamHI"]) insert = cutdna(EGFP, *sites)[1] insert.printsequence(display=True, hide_middle=10)/ pEGFP = joindna(backbone, insert, topology="circular")
Error message
ValueError: The QUEEN_objects cannot be joined due to the end structure incompatibility.
Example code 18: Create a gRNA expression plasmid
pX330 serves as a standard gRNA expression backbone plasmid. A gRNA spacer can simply be cloned into a BbsI-digested destination site of pX330 as follows:
- Generate QUEEN object for a sticky-ended gRNA spacer dsDNA,
- Digest pX330 by BbsI, and
- Assemble the spacer with the BbsI-digested pX330.
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
gRNA = QUEEN(seq="CACCGACCATTGTTCAATATCGTCC----/----CTGGTAACAAGTTATAGCAGGCAAA") sites = plasmid.searchsequence(cutsite.lib["BbsI"]) fragments = cutdna(plasmid, *sites) backbone = fragments[0] if len(fragments[0].seq) > len(fragments[1].seq) else fragment[1] pgRNA = joindna(gRNA, backbone, topology="circular") print(backbone) print(insert) print(pgRNA)
Output
<queen.QUEEN object; project='pX330_26', length='8466 bp', topology='linear'> <queen.QUEEN object; project='EGFP_2', length='787 bp', topology='linear'> <queen.QUEEN object; project='pgRNA', length='8487 bp', topology='circular'>Example code 19: Flip ampicillin-resistant gene in pX330
- Search for the ampicillin-resistant gene in pX330,
- Cut pX330 with start and end positions of the ampicillin-resistant gene,
- Flip the ampicillin-resistant gene fragment, and
- Join it with the other fragment.
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
site = plasmid.searchfeature(query="^AmpR$")[0] fragments = cutdna(plasmid, site.start, site.end) fragments[0] = flipdna(fragments[0]) new_plasmid = joindna(*fragments, topology="circular") plasmid.printfeature(plasmid.searchfeature(query="^AmpR$")) new_plasmid.printfeature(new_plasmid.searchfeature(query="^AmpR$"))
Output
feature_id feature_type qualifiers:label start end strand 2300 CDS AmpR 6803 7664 + feature_id feature_type qualifiers:label start end strand 2400 CDS AmpR 6803 7664 - - inputs:
-
editsequence(input=QUEEN object, source_sequence=regex or str, destination_sequence=str, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")Edit sequence of
QUEEN_objectby searching target sequence fragments matched to asource_sequenceand replacing each of them with adestination_sequence. AllDNAfeature_objectslocated on the edited sequence regions will be given the"qualifiers:broken-feature"attribute. In any sequence edit that confers change in the sequence length of theQUEEN object, the coordinates of all affectedDNAfeature_objectswill be adjusted. This is the parental function ofsearchsequence(). Ifdestination_sequenceis not provided, it works just assearchsequence().Parameters
- input:
QUEEN object - source_sequence:
regexorstr(default:".+")
Source sequence(s) to be replaced. If the value is not provided, the entireQUEEN_objectsequence will be replaced with adestination_sequence. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. All IUPAC nucleotide symbols can also be used. Substrings of theregexvalue can be isolated by enclosing them in parentheses. Each pair of parentheses is indexed sequentially by numbers from left to right. Isolated substrings can be replaced at once by providing adestination_sequencewhere each substring replacement is designated, referring to the index numbers. For details, see https://docs.python.org/3/library/re.html#re.sub - destination_sequence:
str(default:None)
Destination sequence. - start:
int(zero-based indexing; default:0)
Start position of the target range of theQUEEN_objectsequence to be searched for the replacement. - end:int (zero-based indexing; default: the last sequence position of
QUEEN_object)
End position of the target range of theQUEEN_objectsequence to be searched for the replacement. - strand:
int:1(top strand only),-1(bottom strand only), or2(both strands) (default:2)
Sequence strand to be searched for the replacement.
Return
If
destination_sequenceis not provided, it will act assearchsequence()and return alistofDNAFeature_objects. Otherwise,QUEEN_object.Example code 20: Insert an EGFP sequence into pX330
An EGFP sequence insertion to the EcoRI site demonstrated in Example code17 can be described with a simpler code using
editsequence().
(Expected runtime: less than 1 sec.)Source code (continued from the previous code)
EGFP = QUEEN(record="input/EGFP.fasta") pEGFP = editsequence(plasmid, "({})".format(cutsite.lib["EcoRI"].seq), r"\1{}\1".format(EGFP.seq)) print(plasmid) print(pEGFP)
Output
<queen.QUEEN object; project='pX330', length='8484 bp', topology='circular'> <queen.QUEEN object; project='pX330', length='9267 bp', topology='linear'> - input:
-
editfeature(input=QUEEN_object, key_attribute=str, query=regex or str, source=list of DNAfeature_objects, start=int, end=int, strand=int, target_attribute=str, operation=function, quine=bool, new_copy=bool, product=str, process_name=str, process_description="str")Search for
DNAfeature_objectsholding aqueryvalue in a designatedkey_attributeand edit atarget_attributeof the sameDNAfeature_objectswith one of the three operations:removeattribute,replaceattribute, orcreateattribute. This is the parental function ofsearchfeature(). Iftarget_attributeis not provided, it works just assearchfeature().Parameters
- input:
QUEEN object - key_attribute:
str(default:"all")
Attribute type to be searched (feature_id,feature_type,"qualifiers:*", orsequence). If the value is not provided, it will be applied to all of the attributes in theQUEEN_object, excludingsequence. However, if thequeryvalue is provided with only the four nucleotide letters (A, T, G, and C), this value will be automatically set tosequence. - query:
regexorstr(default:".+")
Query term.DNAfeature_objectsthat have a value matches to the query value forkey_attributedesignated above will be subjected to the edit. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. If thekey_attributeissequence, all IUPAC nucleotide symbols can be used. - source:
listofDNAfeature_objects(default:QUEEN_object.dnafeatures)
SourceDNAfeature_objectsto be searched for the editing.DNAfeature_objectsoutside the search range defined bystart,end, andstrandwill be removed from the source. AnyDNAfeature_objectscan be provided here. For example, a list ofDNAfeature_objectsreturned fromsearchsequence()orsearchfeature()operation can be used as the source. - start:
int(zero-based indexing; default:0)
Start position of the target range of theQUEEN_objectsequence for the editing. - end:
int(zero-based indexing; default: the last sequence position ofQUEEN_object)
End position of the target range of theQUEEN_objectsequence for the editing. - strand:
int:1(top strand only),-1(bottom strand only), or2(both strands) (default:2)
Sequence strand to be searched. - target_attribute:
str(default:None)
Attribute type of the targetDNAfeature_objectsto be edited (feature_id,feature_type,"qualifiers:*",strand,start,endorsequence). If the value is not provided, this will work just assearchfeature(). - operation:
removeattribute(),createattribute(value="str")orreplaceattribute(source_value=regex or str, destination_value=str or int)(default:None)
If the operation is not specified, this will work just assearchfeature().removeattribute(): This removestarget_attributefrom the targetDNAfeature_objectsbut only forfeature_idor"qualifiers:*". Iftarget_attributeisfeature_id, the entireDNAfeature_objectswill be erased from theQUEEN_object.createattribute(value="str"): This creates or overwrites target_attributes of the targetDNAfeature_objectswith"str". Iftarget_attributeisfeature_idand there is no existingDNAfeature_objectwith the samefeature_idof"str", it will create the newDNAfeature_objectin theQUEEN_object.dnafeatures. If the search byDNAfeature_objectsdetermines multipleDNAfeature_objectsto be created, eachfeature_idof the newDNAfeature_objectsis generated as"str-number", wherenumbersfollow the order they were searched. If the samefeature_idof"str"already exists in the operatingQUEEN_object.dnafeatures, theDNAfeature_objectwill be generated with thefeature_id="str-number". Iftarget_attributeis"qualifiers:*", the qualifier whose value is"str"will be added into the.qualifiersof the targetDNAfeature_objectas long as it does not overlap with the existing.qualifiers.replaceattribute(source_value=regex or str, destination_value=str or int): This will search for substrings in values of the target_attributes of the targetDNAfeature_objectthat match to thesource_valueand replace them with thedestination_value. Similar toeditsequence(), substrings of theregexvalue can be isolated by enclosing them in parentheses. Each pair of parentheses is indexed sequentially by numbers from left to right. Isolated substrings can be replaced at once by providing adestination_sequencewhere each substring replacement is designated, referring to the index numbers. For details, see https://docs.python.org/3/library/re.html#re.sub. If thetarget_attributeissequence, the sequences corresponding to the targetDNAfeature_objectcan be modified likeeditsequence(). When thesource_valueis not provided, the entire data value will be replaced with thedestination value. If thetarget_attributeisfeature_id, the replacement will be operated only when no conflict with the existingDNAfeature_object. Iftarget_attributeisstart,end, orstrand, nosource_valueis required, and thedestination_valuemust beint.
- quine:
bool(TrueorFalse; default:Trueiftarget_attributeis"sequence". Otherwise,False)
IfFalse, the operation process will not be recorded into the building history. - new_copy:
bool(default:True) IfTrue, it will first generate a copy of theQUEEN_objectand edit it. Otherwise, the originalQUEEN_objectwill be edited directly (Note that this mode does not record the operation process into the building history).
Return
If
operationor target_attribute is not specified, it will act assearchfeature()and return alistofDNAFeature_objects
If new_copy is True,QUEEN_object, otherwiseNone.Example code 21: Insert a DNA string "AAAAA" to the 5’ end of every CDS
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
new_plasmid = editfeature(plasmid, key_attribute="feature_type", query="CDS", strand=1, target_attribute="sequence", operation=replaceattribute(r"(.+)", r"AAAAA\1")) for feat in new_plasmid.searchfeature(key_attribute="feature_type", query="CDS", strand=1): print(feat.start, feat.end, new_plasmid.printsequence(feat.start, feat.start+20, strand=1), feat.qualifiers["label"][0], sep="\t")
Output
1231 1302 AAAAAGACTATAAGGACCAC 3xFLAG 1308 1334 AAAAACCAAAGAAGAAGCGG SV40 NLS 1358 5464 AAAAAGACAAGAAGTACAGC Cas9 5464 5517 AAAAAAAAAGGCCGGCGGCC nucleoplasmin NLS 6823 7689 AAAAAATGAGTATTCAACAT AmpRExample code 22: Convert the feature type of every annotation from "CDS" to "gene"
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
new_plasmid = editfeature(plasmid, key_attribute="feature_type", query="CDS", target_attribute="feature_type", operation=replaceattribute("gene")) new_plasmid.printfeature()
Output
feature_id feature_type qualifier:label start end strand 1 source null 0 8484 + 100 promoter U6 promoter 0 241 + 200 primer_bind hU6-F 0 21 + 300 primer_bind LKO.1 5' 171 191 + 400 misc_RNA gRNA scaffold 267 343 + 500 enhancer CMV enhancer 439 725 + 600 intron hybrid intron 983 1211 + 700 regulatory null 1222 1232 + 800 gene 3xFLAG 1231 1297 + 900 gene SV40 NLS 1303 1324 + 1000 gene Cas9 1348 5449 + 1100 gene nucleoplasmin NLS 5449 5497 + 1200 primer_bind BGH-rev 5524 5542 - 1300 polyA_signal bGH poly(A) signal 5530 5738 + 1400 repeat_region AAV2 ITR 5746 5887 + 1500 repeat_region AAV2 ITR 5746 5876 + 1600 rep_origin f1 ori 5961 6417 + 1700 primer_bind F1ori-R 6048 6068 - 1800 primer_bind F1ori-F 6258 6280 + 1900 primer_bind pRS-marker 6433 6453 - 2000 primer_bind pGEX 3' 6552 6575 + 2100 primer_bind pBRforEco 6612 6631 - 2200 promoter AmpR promoter 6698 6803 + 2300 gene AmpR 6803 7664 + 2400 primer_bind Amp-R 7021 7041 - 2500 rep_origin ori 7834 8423 + 2600 primer_bind pBR322ori-F 8323 8343 +Example code 23: Add single cutter annotations to pX330
- Search for all of the single restriction enzyme cutters in pX330 using the library of restriction enzymes listed on the website of NEW England Biolabs.
- Add the single cutter annotations to pX330.
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
unique_cutters = [] for key, re in cutsite.lib.items(): sites = plasmid.searchsequence(re.cutsite) if len(sites) == 1: unique_cutters.append(sites[0]) else: pass new_plasmid = editfeature(plasmid, source=unique_cutters, target_attribute="feature_id", operation=createattribute("RE")) new_plasmid = editfeature(new_plasmid, key_attribute="feature_id", query="RE", target_attribute="feature_type", operation=replaceattribute("misc_bind")) features = new_plasmid.searchfeature(key_attribute="feature_type", query="misc_bind") new_plasmid.printfeature(features, seq=True)
Output
RE-1 misc_bind Acc65I 433 439 + GGTACC RE-2 misc_bind AgeI 1216 1222 + ACCGGT RE-3 misc_bind ApaI 2700 2706 + GGGCCC RE-4 misc_bind BglII 1595 1601 + AGATCT RE-5 misc_bind BsaBI 4839 4849 + GATCACCATC RE-6 misc_bind BseRI 1098 1104 - GAGGAG RE-7 misc_bind BsmI 4979 4985 + GAATGC RE-8 misc_bind CspCI 4127 4139 + CAAAGCACGTGG RE-9 misc_bind EcoRI 5500 5506 + GAATTC RE-10 misc_bind EcoRV 3196 3202 + GATATC RE-11 misc_bind FseI 5472 5480 + GGCCGGCC RE-12 misc_bind FspI 7365 7371 + TGCGCA RE-13 misc_bind KasI 5887 5893 + GGCGCC RE-16 misc_bind NotI 5738 5746 + GCGGCCGC RE-17 misc_bind PaqCI 1184 1191 + CACCTGC RE-19 misc_bind PmlI 4132 4138 + CACGTG RE-20 misc_bind PsiI 6317 6323 + TTATAA RE-22 misc_bind PvuI 7218 7224 + CGATCG RE-23 misc_bind SacII 7522 7528 + CCGCGG RE-24 misc_bind SbfI 5879 5887 + CCTGCAGG RE-26 misc_bind SnaBI 698 704 + TACGTA RE-27 misc_bind XbaI 427 433 + TCTAGA - input:
Common parameters of the quinable functions
DNA construction process achieved by the search functions searchsequence() and searchfeature(), operational functions cutdna(), cropdna(), modifyends(), flipdna(), and joindna() and super functions editsequence() and editfeature() described up to here can progressively be recorded into the manipulating QUEEN object, which enables to generate a quine code that replicates the same QUEEN object by the quine() function described below. From here, we call these functions "quinable" functions.
In addition to the parameters and options described above for the quinable functions, all of them can commonly take the three parameters, process_name, process_description, and product, that enable annotation and structured visualization of the construction process (see below). These optional parameters do not affect the behavior of the quinable functions.
-
process_name (or pn):
str(default:"") This option enables users to provide label names for process flow groups. An experimental flow composed of sequential operations by quinable functions can be grouped and labeled with a user-defined name by providing the same name to the quinable function operations belonging to the same target group. Such group labels can be, for example,"PCR 1","EcoRI digestion","Gibson Assembly", etc.visualizeflow()described below takes into account the group information to generate experimental flow maps fromQUEEN_objects. -
process_description (or pd):
str(default:"") Similar toprocess_name, this option enables users to provide narrative descriptions of operations conferred by quinable functions. This enables the generation of the whole "Materials and Methods" description for a DNA construction process along with its DNA construction flow from aQUEEN_object(or a QUEEN-generated GenBank file) using thequine()function described below. -
product:
str(default:"") This option enables users to provide label names for producingQUEEN_objects. The provided labels are stored inQUEEN_objects.project.
Quine
quine (input=QUEEN_object, output=str, process_description=bool, execution=bool)
Generate "quine code" of QUEEN_object that produces the same QUEEN_object. A quine code can be executed as a Python script.
Parameters
-
input:
QUEEN_object -
output:
str(default:STDOUT)
Output file name. -
process_description:
bool(default:False)
IfTrue, this will output the process_descriptions registered to quinable operations along with the process flows. The output can be used for the "Material and methods" of theQUEEN_objectconstruction process. -
execution:
bool(default:False)
IfTrue, this will reconstruct theQUEEN_objectby generating and executing its quine code and confirm if the reconstructedQUEEN_objectis identical to the original one. IfexecutionisTrueandoutputisNone, the quine code will be output into a temporary file instead ofSTDOUT; the temporary file will be removed after the operation. The execution won't happen ifprocess_descriptionisTrue.
Return
if
executionisFalse,None. IfexecutionisTrue,Trueif the reconstructedQUEEN_objectis identical to the original one. Otherwise,False.
Example code 24: Obtain the quine code reconstructed pCMV-Target-AID
The Target-AID plasmid (pCMV-Target-AID) was constructed by assembling two fragments encoding the N- and C-terminus halves of Target-AID, which were both amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) (Addgene 79620) using primer pairs RS045/HM129 and HM128/RS046, respectively, with a backbone fragment amplified from pCMV-ABE7.10 using RS047/RS048. The construction process was simulated by using quinable functions, and the GenBank file was generated. The quine code generated from the GenBank file by quine() successfully reconstructed the same GenBank file. The Python scripts for the following Example codes 24-27 can be found in "./demo/tutorial_ex24-28.ipynb".
(Expected runtime: less than 1 sec.)
Source code
from QUEEN.queen import *
︙(ommitted)
pCMV_Target_AID = QUEEN(record="./output/pCMV-Target-AID.gbk")
quine(pCMV_Target_AID, output="./output/pCMV-Target-AID_clone.py")
Shell commands
%python3 ./output/pCMV_Target_AID_clone.py > ./output/clone_pCMV-Target-AID.gbk
%diff -s ./output/pCMV_Target_AID.gbk ./output/clone_pCMV_Target_AID.gbk
Output
Files ./output/clone_pCMV-Target-AID.gbk and ./output/pCMV-Target-AID.gbk are identical.
Example code 25: Inheritance of operational histories
If a QUEEN_object is loaded from a QUEEN-generated GenBank file for a new DNA construction, the quine code of the original QUEEN_object will be inherited into the newly producing QUEEN_object. The following example demonstrates that a QUEEN_object representing a DNA fragment cropped from the QUEEN_object of pCMV-Target-AID holds not only the process history of the cropping but also the whole previous construction process of pCMV-Target-AID.
(Expected runtime: less than 1 sec.)
Source code (continued from the previous code)
description = "Extract a fragment spanning from 8,000 nt to 2,000 nt of pCMV-Target-AID"
cropdna(pCMV_Target_AID, 8000, 2000, product="fragment", process_description=description)
quine(fragment)
Output (quine code generated from the "fragment" product)
︙(ommitted)
description5 = 'Extract a fragment spanning from 8,000 nt to 2,000 nt of pCMV-Target-AID'
cropdna(QUEEN.dna_dict['pCMV-BE4max_8'], start='8000/8000', end='2000/2000', project='pCMV-BE4max', product='fragment', process_description=description5)
There is an option import_history=False prepared for QUEEN() to disable the inheritance of operational process histories of previously generated QUEEN_objects to a newly producing QUEEN_object.
NOTE 1: Editing of quine code
quine() will provide each quinable process in a quine code with a unique process identifier in the process_id option, like "process_id=QUEEN_object.project–XXXXXXXXXXXXXXXXXXXXXXXX", where "Xs" represents md5() transformation of the quinable operation excluding the process_id and original_ids (described below). This process_id serves as a checksum to validate if any modification is provided to the operation code. Therefore, when a new QUEEN script is created by editing a quine code generated from an existing QUEEN_object or combining different process parts from multiple quine codes, the newly generating QUEEN_object will hold these previous process_ids. These process_ids will be passed over to a list original_ids of the corresponding new operation when a new quine code is generated from the new QUEEN_object. Hence, editing histories of quine codes and their inheritances can also be tracked and stored in QUEEN_objects.
NOTE 2: Recording of variable names
By default, QUEEN cannot track and record user-defined variable names of QUEEN_objects used in the original code. Therefore, the .project value of each QUEEN_object is used as its variable name when a quine code is generated. To generate a quine code with user-defined variable names for each operational step, the QUEEN_object needs to be generated with the Python command set_namespace(globals()) executed. This enables providing variable names of producing objects as arguments of their operational functions and, therefore, the recovery of variable names in quine codes.
For example, Example code 19 can be written in this format as follows.
Example code 26: Flip ampicillin-resistant gene in pX330 (variable embedding)
(Expected runtime: less than 1 sec.)
Original code
import sys
from QUEEN.queen import *
set_namespace(globals())
QUEEN(record="input/pX330.gbk", product="plasmid")
plasmid.searchfeature(query="^AmpR$", product="sites")
cutdna(plasmid, sites[0].start, sites[0].end, product="fragments")
flipdna(fragments[0], product="fragments0_rc")
joindna(fragments0_rc, fragments[1], topology="circular", product="new_plasmid")
Quine code
import sys
sys.path.append("/content/colab")
from QUEEN.queen import *
from QUEEN import cutsite as cs
set_namespace(globals())
QUEEN(record='input/pX330.gbk', product='plasmid', process_id='new_plasmid-9WZX2KEVGD9NVBR4DSWNBCSND320', original_ids=[])
plasmid.searchfeature(key_attribute='all', query='^AmpR$', product='sites', process_id='new_plasmid-52D5THPBJ8G961IHBTPEGI4JH321', original_ids=[])
cutdna(plasmid, sites[0].start, sites[0].end, product='fragments', process_id='new_plasmid-2XUXT7UUAIIY5UFUMC8TBPOHC322', original_ids=[])
flipdna(fragments[0], product='fragments0_rc', process_id='new_plasmid-30A7468VURMAE1DIOMS3A7JJP324', original_ids=[])
joindna(*[fragments0_rc, fragments[1]], topology='circular', product='new_plasmid', process_id='new_plasmid-649L08K2L92IMQ1SY8NDKX76B325', original_ids=[])
Visualization
QUEEN provides the following visualization functions.
-
visualizemap(input=QUEEN_object, map_view=str, feature_list=list, start=int, end=int, width_scale=float, height_scale=float, label_location=str, linebreak=int, seq=bool, diameter=float)Generate annotated sequence map of
QUEEN_objectwith selectedDNAfeature_objects. Each feature annotation label is retrieved from the"qualifier:label"attribute. All feature annotations and their label Locations of feature annotation labels are automatically adjusted to prevent overlaps on the sequence map. The face color and edge color of each feature annotation are also automatically assigned from the default colormap. However, they can be determined by"qualifiers:edgecolor_queen"and"qualifiers:facecolor_queen"attributes ofDNAfeature_objects.Parameters
- input:
QUEEN_object - map_view:
str("linear"or"circular"; default:"linear")
Visualization style. - feature_list:
listofDNAfeaure_objects(default:QUEEN_object.dnafeaturesexcluding those with the feature type"source")
DNAfeature_objectsto be displayed on the sequence map. - fontsize:
int(default:12for"circular"map and10for"linear"map)
Common font size. Separate font sizes can also be defined for differentDNAfeaure_objectsby editing the"qualifiers:fontsize_queen"attribute, which overrides the common font size. - labelcolor:
str(default:"black") Common font color for all feature labels. Separate font colors can also be defined for differentDNAfeaure_objectsby editing the"qualifiers:labelcolor_queen"attribute, which overrides the common font color. - display_label:
0,1or2(default:2)
If2, all of the labels will be displayed. If1, only the feature labels that can fit inside the object boxes will be displayed. If0, feature labels won't be displayed. - tick_interval:
int(default:None) Tick interval of sequence map (base pairs).\ - display_axis:
bool(default:True) - title:
str(default:QUEEN_object.project)
Parameters available for only linear maps
- start:
int(zero-based indexing; default:0)
Start position of theQUEEN_objectsequence to be displayed. - end:
int(zero-based indexing; default: the last sequence position ofQUEEN_object)
End position of theQUEEN_objectsequence to be displayed. - width_scale:
float(default:None)
Scaling factor for the width of the sequence map. - height_scale:
float(default:None)
Scaling factor for the height of the sequence map. - label_location:
str(default:"either"whenseqisFalse, otherwise"top")
Feature label locations. Each feature label is generally placed inside the object box. However, if a feature label is larger than the object box, the label will be put outside. If this value is"either", labels will be put below or above the object boxes, whichever is available. If this value is"top", labels will be put above the object boxes. IfseqisTrue, the value must be set to"top". - linebreak:
intorNone(default: Length of theQUEEN_objectsequence)
Sequence length for line break. - seq:
bool(default:False)
WhenTrue, a color map representing theQUEEN_objectsequence will be displayed below the sequence map.
Parameters available for only circular maps
- **diameter_scale ** Scaling factor for the diameter of the sequence map.
Return
matplolib.pyplot.figure objectExample code 27: Visualization of pCMV-Target-AID
(Expected runtime: less than a few min.)
Source code (continued from the example code 24)
fig_a = visualizemap(fragment1, title="fragment-1") fig_b = visualizemap(fragment2, title="fragment-2") fig_c = visualizemap(fragment3, linebreak=120, seq=True, title="fragment-3") features = pCMV_Target_AID.searchfeature(key_attribute="feature_type", query="^(?!.*primer).*$") fig_d = visualizemap(pCMV_Target_AID, feature_list=features, map_view="circular", tick_interval=1000, title="pCMV-Target-AID")
Output figures
- input:
-
visualizeflow(input=list of QUEEN_objects, search_function=bool, grouping=bool, process_classification=bool, intermediate_product=bool)Generate flow charts representing construction processes of
QUEEN_objectswith four different types of nodes: file shape, round, uncolored rectangle, and colored box nodes, representing input gbk files,QUEEN_objects,DNAfeature_objects, and quinable functions, respectively.Parameters
- input:
listofQUEEN_objects - search_function (or sf):
bool(default:True)
IfTrue, the generating flow charts will display all quinable processes involved to produce theQUEEN_objects. Otherwise, operations by the search functions will be omitted in the visualization. - grouping:
bool(default:True)
IfTrue, the operations that has a sameprocess_namewill be grouped by a parental box. - inherited_process (or ip) :
bool(default:False)
IfTrue, the construction process of previousQUEEN_objectsinherited in the presentQUEEN_objectconstruction will also be displayed. - process_description (or pd):
bool(default:False)
IfTrue, bothprocess_namesandprocess_descriptiosnwill be displayed on the top left of the operational object box nodes. IfFalse, onlyprocess_nameswill be displayed on the top center of the operational object box nodes. However, IfgroupingisFalse, none of them will be displayed. - alias_dict:
dict(default:None)
Alias name dictionary forQUEEN_objects.projectnames. This will display the alias names instead ofQUEEN_objects.project.
Return
graphviz.dot.Digraph objectExample code 28: Visualization of the flow chart for pCMV-Target-AID construction
(Expected runtime: less than 1 sec.)
Source code (continued from the example code 24)
graph_a = visualizeflow(pCMV_Target_AID, sf=False,ip=True, grouping=False) graph_b = visualizeflow(pCMV_Target_AID, sf=True, ip=True, grouping=False) graph_c = visualizeflow(pCMV_Target_AID, sf=True, ip=True, grouping=True, pd=True) graph_d = visualizeflow(pCMV_Target_AID) #default setting graph1.render("pCMV-Target-AID_flow1") graph2.render("pCMV-Target-AID_flow2") graph3.render("pCMV-Target-AID_flow3") graph4.render("pCMV-Target-AID_flow4")Output figures
- input:
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distributions
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file python_queen-1.0.1-py3-none-any.whl.
File metadata
- Download URL: python_queen-1.0.1-py3-none-any.whl
- Upload date:
- Size: 87.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/3.7.1 importlib_metadata/4.10.1 pkginfo/1.8.2 requests/2.23.0 requests-toolbelt/0.9.1 tqdm/4.60.0 CPython/3.9.8
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
4e5b56e5224bcd047c529c7cbb4e0e92bb3287d91f4bd1a33d7456a5925642ed
|
|
| MD5 |
c59746718236abeb4102cb8951c0c17a
|
|
| BLAKE2b-256 |
64b917c296fe14068ec625892624915dd31fbe95de00995d36e5a7e5a5a61262
|