pyvariant
What is it?
pyvariant is a Python package for mapping biological sequence variants (mutations) to their equivalent chromosome, cDNA, gene, exon, protein, and RNA positions.
How to get it
The easiest way to get pyvariant is using pip:
pip install pyvariant
The source code is hosted on GitHub at: https://github.com/mattdoug604/pyvariant
How to use it
Before you can use pyvariant, you will need to download the necessary genomic data.
To download and install data from Ensembl, run:
pyvariant install --species <species-name> --release <Ensembl-release-number>
For example:
pyvariant install --species 'homo sapiens' --release 100
At the time of writing, installing a human dataset takes roughly 30-45 minutes and 1.5G of storage space. However, the actual time and space required to install a dataset will depend entirely on the size of the dataset, your computer, internet speed, etc.
By default, the data is downloaded to a platform-specific data directory that is generally only accessible by the user (e.g. /home/<you>/.local/share/pyvariant/). If you want the data to be accessible to other users, or your home directory does have enough storage space, you may to specify a different directory to download to with the --cache option:
pyvariant install --species homo_sapiens --release 100 --cache /path/to/cache/
For more options, run:
pyvariant install --help
Alternatively, you can run the installation from inside a Python process:
>>> from pyvariant import EnsemblRelease
>>> ensembl100 = EnsemblRelease(species='homo_sapiens', release=100, cache_dir="/path/to/cache/")
>>> ensembl100.install()
Once the data is installed, the EnsemblRelease object provides methods for getting information about different features, getting the DNA/RNA/protein sequence at a position, and converting between positions, etc.
Map between feature types
The main use of the package is for converting between equivalent cDNA, DNA, exon, protein, and RNA positions. For example:
cDNA to DNA:
>>> ensembl100.to_dna("ENST00000310581:c.-124C>T")
[DnaSubstitution(refseq='C', altseq='T', contig_id='5', start=1295113, start_offset=0, end=1295113, end_offset=0, strand='-')]
Protein to DNA:
>>> ensembl100.to_dna("BRCA1:p.Q1458*")
[DnaDelins(refseq='CAG', altseq='TAA', contig_id='17', start=43076598, start_offset=0, end=43076600, end_offset=0, strand='-'), DnaDelins(refseq='CAG', altseq='TGA', contig_id='17', start=43076598, start_offset=0, end=43076600, end_offset=0, strand='-'), DnaSubstitution(refseq='C', altseq='T', contig_id='17', start=43076600, start_offset=0, end=43076600, end_offset=0, strand='-')]
Exon to RNA:
>>> ensembl100.to_rna("ENST00000266970:e.7::ENST00000360299:e.2")
[RnaFusion(breakpoint1=RnaPosition(contig_id='12', start=972, start_offset=0, end=2240, end_offset=0, strand='+', gene_id='ENSG00000123374', gene_name='CDK2', transcript_id='ENST00000266970', transcript_name='CDK2-201'), breakpoint2=RnaPosition(contig_id='12', start=63, start_offset=0, end=317, end_offset=0, strand='+', gene_id='ENSG00000111540', gene_name='RAB5B', transcript_id='ENST00000360299', transcript_name='RAB5B-201'))]
You can also limit mapping to the canonical transcript only:
>>> ensembl100 = EnsemblRelease(species='homo_sapiens', release=100, canonical_transcript=["ENST00000000233"])
>>> ensembl100.to_cdna("7:g.127589084", canonical=False)
[CdnaPosition(contig_id='7', start=69, start_offset=0, end=69, end_offset=0, strand='+', gene_id='ENSG00000004059', gene_name='ARF5', transcript_id='ENST00000000233', transcript_name='ARF5-201', protein_id='ENSP00000000233'), CdnaPosition(contig_id='7', start=69, start_offset=0, end=69, end_offset=0, strand='+', gene_id='ENSG00000004059', gene_name='ARF5', transcript_id='ENST00000415666', transcript_name='ARF5-202', protein_id='ENSP00000412701')]
>>> ensembl100.to_cdna("7:g.127589084", canonical=True)
[CdnaPosition(contig_id='7', start=69, start_offset=0, end=69, end_offset=0, strand='+', gene_id='ENSG00000004059', gene_name='ARF5', transcript_id='ENST00000000233', transcript_name='ARF5-201', protein_id='ENSP00000000233')]
Normalize a variant to each possible type:
>>> ensembl100.to_all("ENST00000269305:c.376-2A>G")
[{'cdna': CdnaSubstitution(_core=EnsemblRelease(species=homo_sapiens, release=100), refseq='A', altseq='G', contig_id='17', start=376, start_offset=-2, end=376, end_offset=-2, strand='-', gene_id='ENSG00000141510', gene_name='TP53', transcript_id='ENST00000269305', transcript_name='TP53-201', protein_id='ENSP00000269305'), 'dna': DnaSubstitution(_core=EnsemblRelease(species=homo_sapiens, release=100), refseq='A', altseq='G', contig_id='17', start=7675238, start_offset=0, end=7675238, end_offset=0, strand='-'), 'exon': None, 'protein': None, 'rna': RnaSubstitution(_core=EnsemblRelease(species=homo_sapiens, release=100), refseq='A', altseq='G', contig_id='17', start=566, start_offset=-2, end=566, end_offset=-2, strand='-', gene_id='ENSG00000141510', gene_name='TP53', transcript_id='ENST00000269305', transcript_name='TP53-201')}]
Check if two variants are equivalent
Get the notation(s) that represent both variants:
>>> x = ensembl100.same("ENSP00000358548:p.Q61K", "NRAS:c.181C>A")
>>> x.keys()
dict_keys(['cdna', 'dna', 'exon', 'protein', 'rna'])
>>> x["dna"]
[DnaSubstitution(refseq='C', altseq='A', contig_id='1', start=114713909, start_offset=0, end=114713909, end_offset=0, strand='-')]
...or get the notation(s) that are unique to each variant:
>>> x = ensembl100.diff("ENSP00000358548:p.Q61K", "NRAS:c.181C>A")
>>> x.keys()
dict_keys(['cdna', 'dna', 'exon', 'protein', 'rna'])
>>> x["dna"]
([DnaDelins(refseq='CAA', altseq='AAG', contig_id='1', start=114713907, start_offset=0, end=114713909, end_offset=0, strand='-')], [])
Fetch sequences
Get the mutated reference sequence, within a given window:
>>> ensembl100.sequence("ENST00000635293:c.1044A>C", window=50)
CGCCTCTTTCAGAGACTTTTAACTTCAACATCTGTCCCTACCCAGCAGGC
The sequence can also be normalized to a specific strand of the genome:
>>> ensembl100.sequence("ENST00000635293:c.1044A>C", window=50, strand='+')
GCCTGCTGGGTAGGGACAGATGTTGAAGTTAAAAGTCTCTGAAAGAGGCG
Get the sequence surrounding a fusion breakpoint:
>>> ensembl100.sequence("ENST00000399410:r.2871::ENST00000561813:r.317", window=50)
ACAGTGCAGGGAAGCAACTGCAGAGGCTGTGCAATCTTGCACAAATATCT
Retrieve feature information
pyvariant also has functions for retrieving general information about various features. For example:
Get a list of transcript IDs for a gene:
>>> ensembl100.transcript_ids("BRCA2")
['ENST00000380152', 'ENST00000470094', 'ENST00000528762', 'ENST00000530893', 'ENST00000533776', 'ENST00000544455', 'ENST00000614259', 'ENST00000665585', 'ENST00000666593', 'ENST00000670614', 'ENST00000671466']
For a complete list of methods, run:
>>> help(EnsemblRelease)
Notes
Variant naming standards
This package follows HGVS nomenclature recommendations for representing variants.
Offset positions
When describing variants in an intron or UTR, it can be more informative to describe the position relative to a transcript, rather than the genome. These positions are described with a "+" or "-". For example, "TERT:c.-125" means "a position 125 nucleotides 5’ of the ATG translation initiation codon." See the HGVS nomenclature documentation for more information.
Protein duplications
By default, the package assumes that protein duplications are the result of a nucleotide insertion, as opposed to a delins. This behaviour can be turned of by defining the environmental variable PYVARIANT_GET_ALL_PROTEIN_DUPS.
License
This package is distributed with the MIT license.
Release files for pyvariant 2.2.4
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| pyvariant-2.2.4.tar.gz | 65.0 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| pyvariant-2.2.4-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 115.8 kB
Release files / pyvariant-2.2.4.tar.gz
| Download URL | pyvariant-2.2.4.tar.gz |
|---|---|
| Size | 65.0 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
c8e99069711461d57affb65e1b9cb3917bcd31798aed7b4c63dc385b3d80defd
|
|
BLAKE2b-256 checksum How to use checksums |
e9fe11bfaf92f861e348025dcb0ad56d40cfc84ba07c649aca8a34ff863a8a7e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / pyvariant-2.2.4-py3-none-any.whl
| Download URL | pyvariant-2.2.4-py3-none-any.whl |
|---|---|
| Size | 50.7 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
81b7a5b8ad99f1676df9d82e299f7280c188a012d599469b91b73305a3d43e63
|
|
BLAKE2b-256 checksum How to use checksums |
9f94f22bd27b5588b111762fc4fd56a8b209256e239caa4c79e0583b87c8ff12
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|