Skip to main content

No project description provided

Project description

quickdna

quickdna is a simple, fast library for working with DNA sequences.

>>> from quickdna import DnaSequence, ProteinSequence
>>> d = DnaSequence("taatcaagactattcaaccaa")
>>> d.translate()
ProteinSequence(seq='*SRLFNQ')
>>> d.translate(table=22)
ProteinSequence(seq='**RLFNQ')
>>> d.translate_all_frames()
(ProteinSequence(seq='*SRLFNQ'), ProteinSequence(seq='NQDYST'), ProteinSequence(seq='IKTIQP'))
>>> d[3:9].translate()
ProteinSequence(seq='SR')
>>> d[3:9].reverse_complement()
DnaSequence(seq='TCTTGA')

quickdna is much faster than Biopython for regular DNA translation tasks.

task time comparison
translate_quickdna(small_genome) 0.00306ms / iter
translate_biopython(small_genome) 0.05834ms / iter 1908.90%
translate_quickdna(covid_genome) 0.02959ms / iter
translate_biopython(covid_genome) 3.54413ms / iter 11979.10%
reverse_complement_quickdna(small_genome) 0.00238ms / iter
reverse_complement_biopython(small_genome) 0.00398ms / iter 167.24%
reverse_complement_quickdna(covid_genome) 0.02409ms / iter
reverse_complement_biopython(covid_genome) 0.02928ms / iter 121.55%

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

quickdna-0.1.1.tar.gz (21.8 kB view hashes)

Uploaded Source

Built Distributions

quickdna-0.1.1-cp310-none-win_amd64.whl (107.0 kB view hashes)

Uploaded CPython 3.10 Windows x86-64

quickdna-0.1.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_12_x86_64.manylinux2010_x86_64.whl (928.3 kB view hashes)

Uploaded CPython 3.10 manylinux: glibc 2.12+ x86-64 manylinux: glibc 2.5+ x86-64

quickdna-0.1.1-cp310-cp310-macosx_10_7_x86_64.whl (205.6 kB view hashes)

Uploaded CPython 3.10 macOS 10.7+ x86-64

quickdna-0.1.1-cp39-none-win_amd64.whl (107.0 kB view hashes)

Uploaded CPython 3.9 Windows x86-64

quickdna-0.1.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_12_x86_64.manylinux2010_x86_64.whl (928.5 kB view hashes)

Uploaded CPython 3.9 manylinux: glibc 2.12+ x86-64 manylinux: glibc 2.5+ x86-64

quickdna-0.1.1-cp39-cp39-macosx_10_7_x86_64.whl (205.6 kB view hashes)

Uploaded CPython 3.9 macOS 10.7+ x86-64

quickdna-0.1.1-cp38-none-win_amd64.whl (107.1 kB view hashes)

Uploaded CPython 3.8 Windows x86-64

quickdna-0.1.1-cp38-cp38-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_12_x86_64.manylinux2010_x86_64.whl (928.7 kB view hashes)

Uploaded CPython 3.8 manylinux: glibc 2.12+ x86-64 manylinux: glibc 2.5+ x86-64

quickdna-0.1.1-cp38-cp38-macosx_10_7_x86_64.whl (205.7 kB view hashes)

Uploaded CPython 3.8 macOS 10.7+ x86-64

quickdna-0.1.1-cp37-none-win_amd64.whl (107.0 kB view hashes)

Uploaded CPython 3.7 Windows x86-64

quickdna-0.1.1-cp36-none-win_amd64.whl (106.8 kB view hashes)

Uploaded CPython 3.6 Windows x86-64

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page