quickdna 0.1.3

No project description provided

quickdna

Quickdna is a simple, fast library for working with DNA sequences. It is up to 100x faster than Biopython for some translation tasks, in part because it uses a native Rust module (via PyO3) for the translation. However, it exposes an easy-to-use, statically typed API that should feel familiar for Biopython users.

# These are the two main library types. Unlike Biopython, DnaSequence and ProteinSequence are distinct,
# though they share a common BaseSequence base class
>>> from quickdna import DnaSequence, ProteinSequence

# Sequences can be constructed from strs or bytes, and are stored internally as ascii-encoded bytes
>>> d = DnaSequence("taatcaagactattcaaccaa")

# If no table=... argument is given, NBCI table 1 will be used by default...
>>> d.translate()
ProteinSequence(seq='*SRLFNQ')

# ...but any of the NCBI tables can be specified. A ValueError will be thrown for an invalid table.
>>> d.translate(table=22)
ProteinSequence(seq='**RLFNQ')

# This method will return a tuple of all possible reading frames (seq[:], seq[1:], and seq[2:])
>>> d.translate_all_frames()
(ProteinSequence(seq='*SRLFNQ'), ProteinSequence(seq='NQDYST'), ProteinSequence(seq='IKTIQP'))

# Sequences can be sliced just like regular strings, and return new sequence instances.
>>> d[3:9].translate()
ProteinSequence(seq='SR')

# This exists too!
>>> d[3:9].reverse_complement()
DnaSequence(seq='TCTTGA')

Benchmarks

For regular DNA translation tasks, quickdna is faster than Biopython. (See benchmarks/bench.py for source)

task	time	comparison
translate_quickdna(small_genome)	0.00306ms / iter
translate_biopython(small_genome)	0.05834ms / iter	1908.90%
translate_quickdna(covid_genome)	0.02959ms / iter
translate_biopython(covid_genome)	3.54413ms / iter	11979.10%
reverse_complement_quickdna(small_genome)	0.00238ms / iter
reverse_complement_biopython(small_genome)	0.00398ms / iter	167.24%
reverse_complement_quickdna(covid_genome)	0.02409ms / iter
reverse_complement_biopython(covid_genome)	0.02928ms / iter	121.55%

Installation

Quickdna has prebuilt wheels for Linux (manylinux2010), OSX, and Windows available on PyPi.

Development

Quickdna uses PyO3 and maturin to build and upload the wheels, and poetry for handling dependencies. This is handled via a Justfile, which requires Just, a command-runner similar to make.

Poetry

You can install poetry from https://python-poetry.org, and it will handle the other python dependencies.

Just

You can install Just with cargo install just, and then run it in the project directory to get a list of commands.

Flamegraphs

The just profile command requires cargo-flamegraph, please see that repository for installation instructions.