Skip to main content

Small Complementary RnA Mapper

Project description

SCRAM
-----

--------------

SCRAM is lightweight Python package for aligning small RNA reads to one
or more reference sequences and producing publication-quality images.

Developed by Stephen Fletcher @ the laboratory of Prof. Bernie Carroll,
University of Queensland

--------------

*Installation:*

Scram is written in Python 2.7. Install scram and its dependencies with
``pip``:

``pip install scram``

Or download and extract the tarball, then run:

``python setup.py install``

--------------

*Input File Format:*

Reference File : DNA nucleotides only (AGCT) - FASTA format

Sequence File : Collapsed reads - DNA nucleotides only (AGCT) - FASTA
format

Post-processing of FASTQ reads to collapsed FASTA format can be carried
out using the `FASTX-Toolkit from the Hannon
Lab <http://hannonlab.cshl.edu/fastx_toolkit/>`__. Collapsed reads are
unique, and contain the read count in the header.

An example of the required read file format:

``head seq1.fa``

::

>1-607041
TCGGACCAGGCATCATTCCCC
>2-202886
TCGGACCAGGCTTCATACCCC
>3-71446
TCCCAAATATAGACAAAGCA

--------------

*Usage:*

``scram analysis_type reference_file [-h] [-s1 SEQ_FILE_1] [-s2 SEQ_FILE_2] [-s3 SEQ_FILE_3] [-s4 SEQ_FILE_4] [-nt SRNA_LEN] [-f FILE_NAME] [-seq_list SEQ_LIST] [-min_read MIN_READ_SIZE] [-max_read MAX_READ_SIZE] [-min_count MIN_READ_COUNT] [-win SMOOTH_WIN_SIZE] [-ylim YLIM] [-no_display] [-split] [-pub] [-V]``

Analysis types

- **den** : align reads of a single sRNA class (eg. 21 nt) from a
single sequence file to a single reference sequence (-s1 and -nt
required)
- **mnt3dm** : align 21, 22 and 24 nt reads from a single sequence file
to a single reference sequence (-s1 required)
- **CDP** : count aligned reads of a single sRNA class (eg. 21 nt) to
multiple reference sequences. Counts for two sequence files are
plotted as (x,y) coordinates for each reference (-s1, -s2 and -nt
required)

Flags

- **-h** : Help message
- **-s1** : Sequence file 1
- **-s2** : Sequence file 2
- **-s3** : Sequence file 3
- **-s4** : Sequence file 4
- **-nt** : sRNA length to analyse
- **-f** : Figure output file name (if not auto-generated)
- **-p** : Number of cores (processors) to use (default=4)
- **-seq\_list** : Text (.txt) file with full path of sequence file on
each line (single replicate) or two tab-delimited sequence file paths
per line (two replicates)
- **-min\_read** : Minimum length of sRNA reads used for normalisation
(default=18)
- **-max\_read** : Maximum length of sRNA reads used for normalisation
(default=32)
- **-min\_count** : Minimum read count for an sRNA to be aligned and
used for normalisation (default=1)
- **-win** : Window size for smoothing of den plots (default=50)
- **-ylim** : +/- y-axis limit on plots
- **-no\_display** : Do not display plot on screen
- **-no\_csv** : Do not generate .csv alignment file
- **-split** : Split CDP read alignment counts based on no. of
alignments
- **-pub** : Remove all labels from density maps for publication
- **-V** : Show program's version number and exit

--------------

den example:

``scram den ./ref.fa -s1 seq1.fa -nt 24 -win 30 -f fig1.pdf``

mnt3dm Example:

``scram mnt3dm ./ref.fa -s1 seq1.fa -win 20 -ylim 110 -f fig2.pdf``

CDP Example:

``scram CDP ./cDNAs.fa -s1 seq1.fa -s2 seq2.fa -nt 21 -f fig3.pdf -split``

--------------

(c) 2016 - Stephen Fletcher. MIT License

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

scram-0.5.5.tar.gz (15.4 kB view hashes)

Uploaded Source

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page