Skip to main content

Predict the minimum free energy structure of nucleic acids

Project description

seqfold

Predict the minimum free energy structure of nucleic acids.

seqfold is an implementation of the Zuker, 1981 dynamic programming algorithm, the basis for UNAFold/mfold, plus energy functions from SantaLucia, 2004.

from seqfold import calc_dg

# a bifurcated DNA structure
calc_dg("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC")  # -12.94

Installation

pip install seqfold

Motivation

Knowing about nucleic acid secondary structure is essential in synbio for selecting primers for PCR, designing oligos for MAGE, and tuning RBS expression rates.

While UNAFold and mfold are the most widely used applications for nucleic acid secondary structure prediction, their format and license are restrictive, particularly in a commercial environment. seqfold is meant to be a more open-source and accessible but minimal version of UNAFold/mfold.

seqfold mfold UNAFold
License MIT Academic Non-commercial $200-36,000
OS Linux,MacOS,Windows Linux,MacOS Linux,MacOS,Windows
Format python,CLI python CLI binary CLI binary
Dependencies none (mfold_util) Perl,(gnuplot,GD Library,glut/OpenGL)
Graphical no yes (output) yes (output)
Heterodimers no yes yes
Constraints no yes yes

Citations

That papers and others that were used to develop this library are below. Each paper is listed along with how it relates to seqfold.

Nussinov, 1980

Framework for the dynamic programming approach. It has a conceptually helpful "Maximal Matching" example that demonstrates the approach on a simple sequence with only matched or unmatched bp.

Nussinov, Ruth, and Ann B. Jacobson. "Fast algorithm for predicting the secondary structure of single-stranded RNA." Proceedings of the National Academy of Sciences 77.11 (1980): 6309-6313.

Zuker, 1981

The most cited paper in this space. Extends further than Nussinov, 1980 with a nearest neighbor approach to energies and a consideration of each of stack, bulge, internal loop, and hairpin. Their data structure and traceback method are both more intuitive than Nussinov, 1980.

Zuker, Michael, and Patrick Stiegler. "Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information." Nucleic acids research 9.1 (1981): 133-148.

Jaeger, 1989

Zuker and colleagues expand on the 1981 paper to incorporate penalties for multibranched loops and dangling ends.

Jaeger, John A., Douglas H. Turner, and Michael Zuker. "Improved predictions of secondary structures for RNA." Proceedings of the National Academy of Sciences 86.20 (1989): 7706-7710.

SantaLucia, 2004

The paper from which almost every DNA energy function in seqfold comes from (with the exception of multibranch loops). Provides neighbor entropies and enthalpies for stacks, mismatching stacks, terminal stacks, and dangling stacks. Ditto for bulges, internal loops, and hairpins.

SantaLucia Jr, John, and Donald Hicks. "The thermodynamics of DNA structural motifs." Annu. Rev. Biophys. Biomol. Struct. 33 (2004): 415-440.

Ward, 2017

An investigation of energy functions for multibranch loops that validates the simple linear approach employed by Jaeger, 1989 that keeps runtime at O(n³).

Ward, M., Datta, A., Wise, M., & Mathews, D. H. (2017). Advanced multi-loop algorithms for RNA secondary structure prediction reveal that the simplest model is best. Nucleic acids research, 45(14), 8541-8550.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distributions

No source distribution files available for this release.See tutorial on generating distribution archives.

Built Distributions

seqfold-0.1.3-py3.7.egg (34.2 kB view hashes)

Uploaded Source

seqfold-0.1.3-py2.py3-none-any.whl (18.6 kB view hashes)

Uploaded Python 2 Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page