Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.
Project description
tests |
|
---|---|
package |
Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.
Usage
By default it assumes a DNA sequence with ambiguous characters.
>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
... voucher_code='CP100-09',
... taxonomy={'genus': 'Melitaea',
... 'species': 'phoebe',
... },
... gene_code='EF1a',
... reading_frame=1,
... table=1, # translation table
... )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
'AGYGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
'NNNGARTGGAARACNAARMGNCCN'
>>>
>>> # get first codon positions
>>> seq_record.first_codon_position()
'TGTAAACC'
>>>
>>> # get second codon positions
>>> seq_record.second_codon_position()
'CAGACAGC'
>>>
>>> # get third codon positions
>>> seq_record.third_codon_position()
'TAGGAGTA'
>>>
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
'TCGATGAAACAACGCC'
>>>
>>> # translate to aminoacid sequence
>>> seq_record.translate()
'SEWKTKRP'
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)
'SEWKTKRP'
Installation
pip install seqrecord-expanded
Requirements
pip install -r requirements.txt
Compatibility
Supported Python versions: 2.6, 2.7, 3.3, 3.4, 3.5, 3.11, pypy.
Licence
BSD.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Close
Hashes for seqrecord_expanded-0.2.13.tar.gz
Algorithm | Hash digest | |
---|---|---|
SHA256 | ac43d15755dbe7417e1d2d181ae2ad91d8499b62442a2e895bb369fe26439c0d |
|
MD5 | 98dd47df5122efae161ac419e02904d6 |
|
BLAKE2b-256 | c9929563440fbf92731547e43f6ba48af7695972d8b329a01ce7f13facb7e535 |
Close
Hashes for seqrecord_expanded-0.2.13-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 89d61e38496402a107ee42caa13737c4cfc1f0c08a00b1b0c9c13024a5cad9dc |
|
MD5 | 0ffdef8bf74bd251a5af0ace58d2c16b |
|
BLAKE2b-256 | 344371d6264a2995c04e351b3b2623a1f7ce3b3ab50662102a794b67ce68238e |