Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.
Project description
tests |
|
---|---|
package |
Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.
Usage
By default it assumes a DNA sequence with ambiguous characters.
>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
... voucher_code='CP100-09',
... taxonomy={'genus': 'Melitaea',
... 'species': 'phoebe',
... },
... gene_code='EF1a',
... reading_frame=1,
... table=1, # translation table
... )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
'AGYGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
'NNNGARTGGAARACNAARMGNCCN'
>>>
>>> # get first codon positions
>>> seq_record.first_codon_position()
'TGTAAACC'
>>>
>>> # get second codon positions
>>> seq_record.second_codon_position()
'CAGACAGC'
>>>
>>> # get third codon positions
>>> seq_record.third_codon_position()
'TAGGAGTA'
>>>
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
'TCGATGAAACAACGCC'
>>>
>>> # translate to aminoacid sequence
>>> seq_record.translate()
'SEWKTKRP'
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)
'SEWKTKRP'
Installation
pip install seqrecord-expanded
Requirements
pip install -r requirements.txt
Compatibility
Supported Python versions: 2.6, 2.7, 3.3, 3.4, 3.5, 3.11, pypy.
Licence
BSD.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
File details
Details for the file seqrecord_expanded-0.2.13.tar.gz
.
File metadata
- Download URL: seqrecord_expanded-0.2.13.tar.gz
- Upload date:
- Size: 5.5 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.0.0 CPython/3.11.0
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | ac43d15755dbe7417e1d2d181ae2ad91d8499b62442a2e895bb369fe26439c0d |
|
MD5 | 98dd47df5122efae161ac419e02904d6 |
|
BLAKE2b-256 | c9929563440fbf92731547e43f6ba48af7695972d8b329a01ce7f13facb7e535 |
File details
Details for the file seqrecord_expanded-0.2.13-py3-none-any.whl
.
File metadata
- Download URL: seqrecord_expanded-0.2.13-py3-none-any.whl
- Upload date:
- Size: 6.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.0.0 CPython/3.11.0
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 89d61e38496402a107ee42caa13737c4cfc1f0c08a00b1b0c9c13024a5cad9dc |
|
MD5 | 0ffdef8bf74bd251a5af0ace58d2c16b |
|
BLAKE2b-256 | 344371d6264a2995c04e351b3b2623a1f7ce3b3ab50662102a794b67ce68238e |