Skip to main content
This is a pre-production deployment of Warehouse. Changes made here affect the production instance of PyPI (pypi.python.org).
Help us improve Python packaging - Donate today!

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.

Project Description
tests
package

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.

Usage

By default it assumes a DNA sequence with ambiguous characters.

>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
...                                voucher_code='CP100-09',
...                                taxonomy={'genus': 'Melitaea',
...                                          'species': 'phoebe',
...                                         },
...                                gene_code='EF1a',
...                                reading_frame=1,
...                                table=1,  # translation table
...                                )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
'AGYGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
'NNNGARTGGAARACNAARMGNCCN'
>>>
>>> # get first codon positions
>>> seq_record.first_codon_position()
'TGTAAACC'
>>>
>>> # get second codon positions
>>> seq_record.second_codon_position()
'CAGACAGC'
>>>
>>> # get third codon positions
>>> seq_record.third_codon_position()
'TAGGAGTA'
>>>
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
'TCGATGAAACAACGCC'
>>>
>>> # translate to aminoacid sequence
>>> seq_record.translate()
'SEWKTKRP'
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)
'SEWKTKRP'

Installation

pip install seqrecord-expanded

Requirements

pip install -r requirements.txt

Compatibility

Supported Python versions: 2.6, 2.7, 3.3, 3.4, 3.5, pypy.

Licence

BSD.

Authors

seqrecord-expanded was written by Carlos Peña.

Release History

Release History

This version
History Node

0.2.7

History Node

0.2.6

History Node

0.2.5

History Node

0.2.4

History Node

0.2.3

History Node

0.2.2

History Node

0.2.1

History Node

0.2.0

History Node

0.1.2

History Node

0.1.1

History Node

0.1.0

History Node

0.0.2

History Node

0.0.1

Download Files

Download Files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
seqrecord_expanded-0.2.7-py3-none-any.whl (8.0 kB) Copy SHA256 Checksum SHA256 3.5 Wheel Sep 28, 2017
seqrecord_expanded-0.2.7.tar.gz (4.9 kB) Copy SHA256 Checksum SHA256 Source Sep 28, 2017

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting