Skip to main content

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.

Project description

tests
Travis-CI Build Status Requirements Status Coverage Status
Code issues
package PyPI Package latest release PyPI Wheel Supported versions Supported implementations

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.

Usage

By default it assumes a DNA sequence with ambiguous characters.

>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
...                                voucher_code='CP100-09',
...                                taxonomy={'genus': 'Melitaea',
...                                          'species': 'phoebe',
...                                         },
...                                gene_code='EF1a',
...                                reading_frame=1,
...                                table=1,  # translation table
...                                )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
'AGYGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
'NNNGARTGGAARACNAARMGNCCN'
>>>
>>> # get first codon positions
>>> seq_record.first_codon_position()
'TGTAAACC'
>>>
>>> # get second codon positions
>>> seq_record.second_codon_position()
'CAGACAGC'
>>>
>>> # get third codon positions
>>> seq_record.third_codon_position()
'TAGGAGTA'
>>>
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
'TCGATGAAACAACGCC'
>>>
>>> # translate to aminoacid sequence
>>> seq_record.translate()
'SEWKTKRP'
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)
'SEWKTKRP'

Installation

pip install seqrecord-expanded

Requirements

pip install -r requirements.txt

Compatibility

Supported Python versions: 2.6, 2.7, 3.3, 3.4, 3.5, pypy.

Licence

BSD.

Authors

seqrecord-expanded was written by Carlos Peña.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for seqrecord_expanded, version 0.2.10
Filename, size File type Python version Upload date Hashes
Filename, size seqrecord_expanded-0.2.10-py3-none-any.whl (8.3 kB) File type Wheel Python version 3.5 Upload date Hashes View hashes
Filename, size seqrecord_expanded-0.2.10.tar.gz (5.2 kB) File type Source Python version None Upload date Hashes View hashes

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN DigiCert DigiCert EV certificate StatusPage StatusPage Status page