sigalign 0.3.1

SigAlign's language binding for python

SigAlign for Python

SigAlign is a sequence alignment algorithm. This repository hosts the Python language bindings for SigAlign. The original project can be found here.

Requirements

• Python >= 3.10

Installation

• Via pip

  pip install sigalign
  

• Manual build: SigAlign relies on maturin as a backend. To build manually:

  pip install maturin
  maturin develop
  

Usage Example

(1) Import SigAlign

from sigalign import Reference, Aligner

(2) Construct Reference

# Build Reference object from `iterable` of tuples (label, sequence).
reference = Reference.from_iterable([
    ("target_1", "ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA"),
    ("target_2", "TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC"),
])
# Or only sequences
reference = Reference.from_iterable([
    "ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA",
    "TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC",
])
# Bytes can be used instead of strings
reference = Reference.from_iterable([
    b"ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA",
    b"TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC",
])

# FASTA format can be used
reference = Reference.from_fasta(b""">target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC""")
# Or from a file
# reference = Reference.from_fasta_file("reference.fasta")

Check status of Reference

print("# Reference Status")
print(f" - Num targets: {reference.num_targets}")
print(f" - Total length: {reference.total_length} bps")
print(f" - Estimated size: {reference.estimated_size / 1024:.2f} KiB")

• Output:

  # Reference Status
    - Num targets: 2
    - Total length: 140 bps
    - Estimated size: 1.32 KiB
  

Parse target label and sequence

for target_index in range(reference.num_targets):
    print(f"# Target {target_index}")
    print(f"  - Label: {reference.get_label(target_index)}")
    print(f"  - Sequence: {reference.get_sequence(target_index)}")

• Output:

  # Target 0
    - Label: target_1
    - Sequence: ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
  # Target 1
    - Label: target_2
    - Sequence: TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC
  

Save and load

# Save
reference.save_to_file("reference.sigref")

# Load
reference = Reference.load_from_file("reference.sigref")

(3) Initialize Aligner

aligner = Aligner(
    4,     # Mismatch penalty
    6,     # Gap-open penalty
    2,     # Gap-extend penalty
    50,    # Minimum length
    0.2,   # Maximum penalty per length
    use_local_mode=True, # Use local alignment (default: True)
    use_limit=None,      # Limit the number of alignments (default: None)
    use_chunk=None,      # Align with chunked query with (chunk size, sliding window size) (default: None)
)

Check status of Aligner

print("# Aligner Status")
print("  - Penalties")
print(f"    - Mismatch penalty: {aligner.px}")
print(f"    - Gap-open penalty: {aligner.po}")
print(f"    - Gap-extend penalty: {aligner.pe}")
print("  - Similarity Cutoffs")
print(f"    - Minimum length: {aligner.minl}")
print(f"    - Maximum penalty per length: {aligner.maxp:.2f}")
print(f"  - Mode is {'Local' if aligner.is_local_mode else 'Semi-global'}")
print(f"    - Max alignments: {'Infinity' if aligner.limitation is None else aligner.limitation}")
print(f"    - Chunk: {aligner.chunk}")

• Output:

  # Aligner Status
  - Penalties
      - Mismatch penalty: 4
      - Gap-open penalty: 6
      - Gap-extend penalty: 2
  - Similarity Cutoffs
      - Minimum length: 50
      - Maximum penalty per length: 0.20
  - Mode is Local
      - Max alignments: Infinity
      - Chunk: None
  

(4) Perform Alignment

# Align a query str to the reference
query = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(query, reference)

# Or query bytes can be used
query = b"CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(query, reference, with_label=True) # including label is slightly slower than without label (default: False)

# FASTA (str or bytes) can be used
fasta = b""">query_1
CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"""
results = aligner.align_fasta(
    fasta,
    reference,
)
# Or file can be used:
# results = aligner.align_fasta_file(
#     "path/to/file.fasta",
#     reference,
# )

# FASTQ (str or bytes) can be used:
fastq = b"""@query_1
CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII"""
results = aligner.align_fastq(
    fastq,
    reference,
    with_label=True, # include label in the result (default: False)
    with_reverse_complementary=False, # align both forward and reverse complementary (default: False)
    allow_interrupt=True, # allow interrupting with KeyboardInterrupt (default: False)
)
# Or file can be used:
# results = aligner.align_fastq_file(
#     "path/to/file.fastq",
#     reference,
# )

(5) Display Results

for read_alignment in results:
    print(f"# Query: {read_alignment.read} (is forward: {read_alignment.is_forward})")
    for target_alignment in read_alignment.result:
        print(f"  - Target: {target_alignment.label} (index {target_alignment.index})")
        for idx, alignment in enumerate(target_alignment.alignments):
            print(f"    - Result {idx+1}")
            print(f"      * Penalty: {alignment.penalty}")
            print(f"      * Length: {alignment.length}")
            print(f"      * Query position: {alignment.query_position}")
            print(f"      * Target position: {alignment.target_position}")

• Output:

  # Query: query_1 (is forward: True)
  - Target: target_1 (index 0)
      - Result 1
      - Penalty: 8
      - Length: 60
      - Query position: (0, 60)
      - Target position: (10, 70)
  - Target: target_2 (index 1)
      - Result 1
      - Penalty: 8
      - Length: 51
      - Query position: (10, 60)
      - Target position: (9, 60)
  

Convert results to json or dict

import json
json.loads(results.to_json())

• Output:

  [{'read': 'query_1',
  'is_forward': True,
  'result': [{'index': 0,
      'label': 'target_1',
      'alignments': [{'penalty': 8,
      'length': 60,
      'query_position': [0, 60],
      'target_position': [10, 70],
      'operations': [{'operation': 'Match', 'count': 27},
      {'operation': 'Subst', 'count': 1},
      {'operation': 'Match', 'count': 17},
      {'operation': 'Subst', 'count': 1},
      {'operation': 'Match', 'count': 14}]}]},
  {'index': 1,
      'label': 'target_2',
      'alignments': [{'penalty': 8,
      'length': 51,
      'query_position': [10, 60],
      'target_position': [9, 60],
      'operations': [{'operation': 'Match', 'count': 23},
      {'operation': 'Deletion', 'count': 1},
      {'operation': 'Match', 'count': 27}]}]}]}]
  

Convert results to a table

import pandas as pd
df = pd.DataFrame(
    results.to_rows(),
    columns = [
        'query_label', 'is_forward',
        'target_index', 'target_label', 'penalty', 'length',
        'query_start', 'query_end', 'target_start', 'target_end', 'operations',
    ],
)
df

• Output:

  	query_label	is_forward	target_index	target_label	penalty	length	query_start	query_end	target_start	target_end	CIGAR
  0	query_1	TRUE	1	target_2	8	51	10	60	9	60	23=1D27=
  1	query_1	TRUE	0	target_1	8	60	0	60	10	70	27=1X17=1X14=

import polars as pl
df = pl.DataFrame(
    results.to_rows(),
    orient="row",
    schema=[
        'query_label', 'is_forward',
        'target_index', 'target_label', 'penalty', 'length',
        'query_start', 'query_end', 'target_start', 'target_end', 'operations',
    ],
)
df

• Output:

  query_label	is_forward	target_index	target_label	penalty	length	query_start	query_end	target_start	target_end	CIGAR
  str	bool	i64	str	i64	i64	i64	i64	i64	i64	str
  "query_1"	true	1	"target_2"	8	51	10	60	9	60	"23=1D27="
  "query_1"	true	0	"target_1"	8	60	0	60	10	70	"27=1X17=1X14="

Additional Information

This Python library provides bindings for the Rust crate sigalign. It offers a set of functions sufficient for most common tasks. However, for more customization, using the Rust crate directly is recommended.

Support

For any questions or issues, please refer to the original project's GitHub issue tracker.

License

SigAlign for Python is released under the MIT license.

Citation

Bahk, K., & Sung, J. (2024). SigAlign: an alignment algorithm guided by explicit similarity criteria. Nucleic Acids Research, gkae607.