spaTyper.py: Generate spa type identification
Version: 0.3.3
USAGE: spaTyper [-h] [-r REPEAT_FILE] [-o REPEAT_ORDER_FILE] [-d FOLDER] [-f FASTA [FASTA ...]] [-g GLOB] [--output OUTPUT] [-e] [--version] [--debug]
Prints spa type to stdout - egenomics letter combination and then the ridom spa type. If multiple pcr products are found will print spa types for each product. It downloads sparepeats.fasta and spatypes.txt from the ridom server to repository directory if files not provided or already in directory.
optional arguments:
-h, --help show this help message and exit
-r REPEAT_FILE, --repeat_file REPEAT_FILE List of spa repeats (http://spa.ridom.de/dynamic/sparepeats.fasta)
-o REPEAT_ORDER_FILE, --repeat_order_file REPEAT_ORDER_FILE List spa types and order of repeats (http://spa.ridom.de/dynamic/spatypes.txt)
-d FOLDER, --folder FOLDER Folder to save downloaded files from Ridom/Spa server
-f FASTA [FASTA ...], --fasta FASTA [FASTA ...] List of one or more fasta files.
-g GLOB, --glob GLOB Uses unix style pathname expansion to run spa typing on all files. If your shell autoexpands wildcards use -f.
-e, --do_enrich Do PCR product enrichment. [Default: False]
--output OUTPUT Provide an output file or print by default using standard out.
--version show program's version number and exit
--debug Developer messages
Installation
It requires python 3. Install it using pip package (https://pypi.org/project/spaTyper/)
pip install spaTyper
or clone the repository and install it using setup.py
git clone https://github.com/JFsanchezherrero/spa_typing.git
cd spa_typing
pip install setup.py
How it works
Given a fasta file or multiple fasta files, this script identifies the repeats and the order and generates a spa type.
The repeat sequences and repeat orders found on http://spaserver2.ridom.de/ are used to identify the spa type of each enriched sequence.
Ridom spa type and the egenomics repeat sequence are then reported back to the user.
If enriched option provided, the script searches for 50bp to 5000bp sequences produced by the following primer sets
TAAAGACGATCCTTCGGTGAG, CAGCAGTAGTGCCGTTTGCTT
AGACGATCCTTCGGTGAGC, GCTTTTGCAATGTCATTTACTG
ATAGCGTGATTTTGCGGTT, CTAAATATAAATAATGTTGTCACTTGGA
CAACGCAATGGTTTCATCCA, GCTTTTGCAATGTCATTTACTG
If an enriched sequence is found by a primer set, subsequent primer sets are not used.
Load it as a module
This scripts can be loaded and installed as a python module. Python 3 version only.
import spaTyper
## download file repeats
repeat_file = spaTyper.utils.download_file_repeats(folder, False)
## download file repeats
repeat_order_file = spaTyper.utils.download_file_types(folder, False)
## Get the SpaTypes in fasta sequences
seqDict, letDict, typeDict, seqLengths = spaTyper.spa_typing.getSpaTypes(repeat_file, repeat_order_file, False)
## read fasta file
fasta_file = "my_genome.fasta"
qDict = spaTyper.utils.fasta_dict(fasta_file)
## find pattern
for i in qDict.keys():
pattern = spaTyper.spa_typing.findPattern(qDict[i], seqDict, seqLengths, debug)
if pattern:
if j in pattern.keys():
splitted = pattern[j].split('::')
print("Sequence name: ",j, "Repeats:", splitted[2], "Repeat Type:", splitted[1], '\n')
Copyright
Original code written by mjsull (https://github.com/mjsull/spa_typing)
Jose F. Sanchez-Herrero updated the code, change to python3, and set to use it as a module
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file spaTyper-0.3.3.tar.gz.
File metadata
- Download URL: spaTyper-0.3.3.tar.gz
- Upload date:
- Size: 157.7 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.2.0 pkginfo/1.5.0.1 requests/2.24.0 setuptools/41.2.0 requests-toolbelt/0.9.1 tqdm/4.48.2 CPython/3.7.6
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
885398b7a4044419430ec51464c6fe2267bdb6487c0fc945fde302145e659b0c
|
|
| MD5 |
6c03971cde4c944d09cd0a55ab0bd135
|
|
| BLAKE2b-256 |
5dabc0c69c52a945f2170e54fa3ad9647352ca53a8519515aa0c355b2ba02171
|
File details
Details for the file spaTyper-0.3.3-py3-none-any.whl.
File metadata
- Download URL: spaTyper-0.3.3-py3-none-any.whl
- Upload date:
- Size: 165.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.2.0 pkginfo/1.5.0.1 requests/2.24.0 setuptools/41.2.0 requests-toolbelt/0.9.1 tqdm/4.48.2 CPython/3.7.6
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
cc990e16205716415797400c86f90c358acaccc311edc854d69acfd8acc27349
|
|
| MD5 |
6723116baed284818f4b9a9fd098a894
|
|
| BLAKE2b-256 |
8dee86f01f6c2be70aa7b5d5e71dbd4a34f4290808a7eefb1b136bbee76f8c3a
|