Skip to main content

DNA Sequence Visualization for Humans.

Project description

Logo

Build Status CodeFactor Docs PyPI

Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this:

>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
>lcl|NC_005100.4_cds_NP_150237.1_1 [gene=HBB]
ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGGGGAAAGGTGAACCCTGATGATG
TTGGTGGCGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGAGGTACTTTGATAGCTTTGG
GGACCTGTCCTCTGCCTCTGCTATCATGGGTAACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGATAAAC
GCCTTCAATGATGGCCTGAAACACTTGGACAACCTCAAGGGCACCTTTGCTCATCTGAGTGAACTCCACT
GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACATGATTGTGATTGTGTTGGGCCA
CCACCTGGGCAAGGAATTCTCCCCCTGTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCAGT
GCCCTGGCTCACAAGTACCACTAA

into gorgeous, interactive visualizations like this:

Human Squiggle

Installation

If you don't have Python 3.4 or greater installed, be sure to get it . To get the current stable version of Squiggle, run:

$ pip install squiggle

Or, alternatively, if you want to get the latest development version:

$ pip install git+https://github.com/Lab41/squiggle.git

Usage

Using Squiggle is as easy as:

$ squiggle your_sequence.fasta

Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation here.

Citation

To be determined!

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for squiggle, version 0.3.1
Filename, size File type Python version Upload date Hashes
Filename, size squiggle-0.3.1-py2.py3-none-any.whl (7.9 kB) File type Wheel Python version py2.py3 Upload date Hashes View hashes
Filename, size squiggle-0.3.1.tar.gz (8.8 kB) File type Source Python version None Upload date Hashes View hashes

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN DigiCert DigiCert EV certificate StatusPage StatusPage Status page