Skip to main content

DNA Sequence Visualization for Humans.

Project description

Logo

Build Status CodeFactor Docs PyPI

Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this:

>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
>lcl|NC_005100.4_cds_NP_150237.1_1 [gene=HBB]
ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGGGGAAAGGTGAACCCTGATGATG
TTGGTGGCGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGAGGTACTTTGATAGCTTTGG
GGACCTGTCCTCTGCCTCTGCTATCATGGGTAACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGATAAAC
GCCTTCAATGATGGCCTGAAACACTTGGACAACCTCAAGGGCACCTTTGCTCATCTGAGTGAACTCCACT
GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACATGATTGTGATTGTGTTGGGCCA
CCACCTGGGCAAGGAATTCTCCCCCTGTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCAGT
GCCCTGGCTCACAAGTACCACTAA

into gorgeous, interactive visualizations like this:

Human Squiggle

Installation

If you don't have Python 3.4 or greater installed, be sure to get it . To get the current stable version of Squiggle, run:

$ pip install squiggle

Or, alternatively, if you want to get the latest development version:

$ pip install git+https://github.com/Lab41/squiggle.git

Usage

Using Squiggle is as easy as:

$ squiggle your_sequence.fasta

Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation here.

Citation

To be determined!

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

squiggle-0.3.1.tar.gz (8.8 kB view hashes)

Uploaded source

Built Distribution

squiggle-0.3.1-py2.py3-none-any.whl (7.9 kB view hashes)

Uploaded py2 py3

Supported by

AWS AWS Cloud computing Datadog Datadog Monitoring Facebook / Instagram Facebook / Instagram PSF Sponsor Fastly Fastly CDN Google Google Object Storage and Download Analytics Huawei Huawei PSF Sponsor Microsoft Microsoft PSF Sponsor NVIDIA NVIDIA PSF Sponsor Pingdom Pingdom Monitoring Salesforce Salesforce PSF Sponsor Sentry Sentry Error logging StatusPage StatusPage Status page