DNA Sequence Visualization for Humans.
Project description
Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this:
>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
into gorgeous, interactive visualizations like this:
Installation
If you don't have Python 3.4 or greater installed, be sure to get it . To get the current stable version of Squiggle, run:
$ pip install squiggle
Or, alternatively, if you want to get the latest development version:
$ pip install git+https://github.com/Lab41/squiggle.git
Usage
Using Squiggle is as easy as:
$ squiggle your_sequence.fasta
Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation here.
Citation
To be determined!
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
File details
Details for the file squiggle-0.1.2.tar.gz
.
File metadata
- Download URL: squiggle-0.1.2.tar.gz
- Upload date:
- Size: 7.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 488c47c691d37f1c9870c6bebb78beba1d021457fd1304f4a53e15370c4b6cde |
|
MD5 | 143434d60c3416f6d4766311ddbf5bfc |
|
BLAKE2b-256 | a2ef5d85b5a0cadc53463dfcdf3f32f64cc42e09b72a984e677598794e6dce4d |
File details
Details for the file squiggle-0.1.2-py2.py3-none-any.whl
.
File metadata
- Download URL: squiggle-0.1.2-py2.py3-none-any.whl
- Upload date:
- Size: 6.8 kB
- Tags: Python 2, Python 3
- Uploaded using Trusted Publishing? No
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 6923ef356ec0db53b176c5a56abd82a9cef9a50fc989334fa6db088855de1ab3 |
|
MD5 | 8473ebdc08c0adcf05baa8102204d1c6 |
|
BLAKE2b-256 | 43855c27b07b48276198f26edfef79ddbe83de19556c497a00d510efda097503 |