Skip to main content

DNA Sequence Visualization for Humans.

Project description

Logo

Build Status Cov CodeFactor Docs PyPI

Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this:

>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA

into gorgeous, interactive visualizations like this:

Human Squiggle

Installation

If you don't have Python 3.4 or greater installed, be sure to get it . To get the current stable version of Squiggle, run:

$ pip install squiggle

Or, alternatively, if you want to get the latest development version:

$ pip install git+https://github.com/Lab41/squiggle.git

Usage

Using Squiggle is as easy as:

$ squiggle your_sequence.fasta

Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation here.

Citation

To be determined!

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

squiggle-0.2.0.tar.gz (8.5 kB view details)

Uploaded Source

Built Distribution

squiggle-0.2.0-py2.py3-none-any.whl (7.6 kB view details)

Uploaded Python 2 Python 3

File details

Details for the file squiggle-0.2.0.tar.gz.

File metadata

  • Download URL: squiggle-0.2.0.tar.gz
  • Upload date:
  • Size: 8.5 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for squiggle-0.2.0.tar.gz
Algorithm Hash digest
SHA256 515b94c0cb91627db59f64f115b138f8538b4351c0ab1b71ae898e5ea595b5ec
MD5 9f4ea96ac3c673920bffcf12e6c30175
BLAKE2b-256 9e507cd68a202b5fa5055efb48c5feebaa416b8056e059ba845fc819d268a126

See more details on using hashes here.

File details

Details for the file squiggle-0.2.0-py2.py3-none-any.whl.

File metadata

File hashes

Hashes for squiggle-0.2.0-py2.py3-none-any.whl
Algorithm Hash digest
SHA256 64fb689881352c95b115f91bac2250de2640036f93a13de09b3755055a29e1b5
MD5 a369bb47a697f91f61805ddd12686fb6
BLAKE2b-256 7b07a230bde8b3b1388bcb32b458bde9e9ee712e8a97f782d78076fe306766cc

See more details on using hashes here.

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page