stranger 0.9.2

Annotate VCF files with str variants

Stranger

Annotates output files from ExpansionHunter and TRGT with the pathologic implications of the repeat sizes.

Installation

git clone github.com/clinical-genomics/stranger
cd stranger
pip install --editable .

Usage

Usage: stranger [OPTIONS] VCF

  Annotate str variants with str status

Options:
  -f, --repeats-file PATH         Path to a file with repeat definitions. See
                                  README for explanation  [default: $HOME/
                                  stranger/stranger/resources/vari
                                  ant_catalog_grch37.json]
  -i, --family_id TEXT
  -t, --trgt                      File was produced with TRGT
  --version
  --loglevel [DEBUG|INFO|WARNING|ERROR|CRITICAL]
                                  Set the level of log output.  [default:
                                  INFO]
  --help                          Show this message and exit.

Repeat definitions

The repeats are called with Expansion Hunter as mentioned earlier. ExpansionHunter will annotate the number of times that a repeat has been seen in the bam files of each individual and what repeat id the variant has. Stranger will annotate the level of pathogenicity for the repeat number. The intervals that comes with the package are manually collected from the literature since there is no single source where this information can be collected.

You can find a demo repeat definitions json file that comes with Stranger here. It is based on the ExpansionHunter variant catalog, but extended with a few disease locus relevant keys: It is advisable to use an up to date file, perhaps based on a curated public repostitory such as STRchive or STRipy. The ones we use in our routine pipelines can be found at our Reference-files repository and include our literature curation.

Column/Key	Content/Value
HGNC_ID	HGNC identifier for the repeat or most associated gene.
HGNC_SYMBOL	HGNC symbol for the repeat or most associated gene.
REPID	ExpansionHunter repeat ID.
RU	Basic repeat unit, as seen in ExpansionHunter. Unused.
DisplayRU	Repeat unit, as clinicians are used to see it.
Normal_Max	(#copies) Longest repeat expected for normal individual; higher are marked pre- or full-mutation
Pathologic_Min	(#copies) Shortest repeat expected for pathology. This and higher is annotated as full-mutation.
Disease	Associated disease.
InheritanceMode	Mode of inheritance "AR", "AD", "XR" etc
Source	Reference literature resource type, eg GeneReviews or PubMed
SourceId	PMID or GeneReviews book ID for references
TRID	Trgt repeat ID if not same as REPID
PathologicStruc	Array of index for pathogenic motif

Other fields accepted by ExpansionHunter are also encouraged.

For convenience, here is a formatted table with some of the current contents.

HGNCId	LocusId	DisplayRU	InheritanceMode	normal_max	pathologic_min	Disease	SourceDisplay	SourceId
3776	AFF2	CCG	XR	39	200	Fraxe	GeneReviews Internet 2019-11-07	NBK535148
644	AR	CAG	XR	34	38	SBMA	GeneReviews Internet 2019-11-07	NBK535148
18060	ARX_EIEE	GCN	XR	16	17	EIEE	GeneReviews Internet 2019-11-07	NBK535148
18060	ARX_PRTS	GCN	XR	12	20	PRTS	GeneReviews Internet 2019-11-07	NBK535148
3033	ATN1	CAG	AD	35	48	DRPLA	GeneReviews Internet 2019-11-07	NBK535148
10549	ATXN10	ATTCT	AD	32	800	SCA10	GeneReviews Internet 2019-11-07	NBK535148
10548	ATXN1	CAG	AD	35	45	SCA1	GeneReviews Internet SCA1 2017-06-22	NBK1184
10555	ATXN2	CAG	AD	31	37	SCA2	GeneReviews Internet SCA2 2019-02-14	NBK1275
7106	ATXN3	CAG	AD	44	60	MJD	GeneReviews Internet 2019-11-07	NBK535148
10560	ATXN7	CAG	AD	19	36	SCA7	GeneReviews Internet 2019-11-07	NBK535148
10561	ATXN8OS	CTG	AD	50	80	SCA8	GeneReviews Internet 2019-11-07	NBK535148
28337	C9ORF72	GGCCCC	AD	25	40	FTDALS1	GeneReviews Internet 2019-11-07	NBK535148
1388	CACNA1A	CAG	AD	18	20	SCA6	GeneReviews Internet 2019-11-07	NBK535148
1541	CBL	CCG	AD	79	100	FRAX11B	Jones et al Nature 1995	7603564
1541	BEAN1	TGGAA	AD	10	40	SCA31	Sato et al AJHG 2009	7603564
13164	CNBP	CCTG	AD	30	75	DM2	GeneReviews Internet 2020-03-19	NBK1466
2482	CSTB	CCCCGCCCCGCG	AR	3	30	EPM1	GeneReviews Internet 2019-11-07	NBK535148
2482	DAB1	ATTTC	AD	16	31	SCA37	GeneReviews Internet 2019-05-30	NBK541729
29284	DIP2B	CGG	AD	24	270	FRA12A	GeneReviews Internet 2019-11-07	NBK535148
2933	DMPK	CTG	AD	34	50	DM1	GeneReviews Internet 2019-10-03	NBK1165
18683	EIF4A3	TCGGCAGCGGCGCAGCGAGG	AR	9	10	RCPS	GeneReviews Internet 2019-11-07	NBK535148
3775	FMR1	CGG	XR	55	200	FragileX	GeneReviews Internet 2019-11-07	NBK535148
1092	FOXL2	GCN	AD	14	15	BPES	GeneReviews Internet 2019-11-07	NBK535148
3951	FXN	GAA	AR	35	51	FRDA	GeneReviews Internet 2019-11-07	NBK535148
4331	GLS	GCA	AR	20	90	GDPAG	van Kuilenburg et al (2019) NEJM 380:1433-1441	30970188
5102	HOXA13_I	GCN	AD	14	22	HFGS	GeneReviews Internet 2019-08-08	NBK1423
5102	HOXA13_II	GCN	AD	12	18	HFGS	GeneReviews Internet 2019-08-08	NBK1423
5102	HOXA13_III	GCN	AD	18	24	HFGS	GeneReviews Internet 2019-08-08	NBK1423
5136	HOXD13	GCN	AD	15	22	SDTY5	GeneReviews Internet 2019-11-07	NBK535148
4851	HTT	CAG	AD	36	40	Huntington	GeneReviews Internet 2020-06-11	NBK1305
14203	JPH3	CTG	AD	28	40	HDL2	GeneReviews Internet 2019-06-27	NBK1529
31708	LRP12	CGN	AD	45	90	OPDM1	GeneReviews Internet 2019-11-07	NBK535148
1226	GIPC1	GGC	AD	32	73	OPDM2	Deng et al (2020) AJHG 106(6):793-804	32413282
17043	NIPA1	GCN	AD	8	10000	ALS - susceptibility to	Tazelaar et al (2019) Neurobiol Aging 74:234.e9-234.e15	30342764
15911	NOP56	GGCCTG	AD	14	650	SCA36	GeneReviews Internet 2014-08-07	NBK231880
53924	NOTCH2NLC	CGG	AD	38	66	NIID	GeneReviews Internet 2019-11-07	NBK535148
8565	PABPN1	GCN	AD	10	12	OPMD	GeneReviews Internet 2014-02-20	NBK1126
9143	PHOX2B	GCN	AD	20	25	CCHS	GeneReviews Internet 2014-01-30	NBK1427
9305	PPP2R2B	CAG	AD	32	51	SCA12	GeneReviews Internet 2019-11-07	NBK535148
16854	RAPGEF2	TTTCA	AD	1	10	FAME7	Ishiura et al (2018) Nature Genetics 50;581-90	29507423
9969	RFC1	AARRG	AR	11	12	CANVAS	Cortese et al 2019 Nat Gen PMID: 30926972	30926972
31750	SAMD12	TTTCA	AD	1	10	FAME1	Ishiura et al (2018) Nature Genetics 50;581-90	29507423
10472	RUNX2	GCN	AD	17	20	CCD	GeneReviews Internet 2019-11-07	NBK535148
11199	SOX3	GCN	XR	15	22	MRGH	GeneReviews Internet 2019-11-07	NBK535148
11588	TBP	CAN	AD	40	49	SCA17	GeneReviews Internet 2019-09-12	NBK1438
11592	TBX1	GCN	AD	15	25	TOF	GeneReviews Internet 2019-11-07	NBK535148
11634	TCF4	CTG	AD	39	100	FECD3	GeneReviews Internet 2019-11-07	NBK535148
11969	TNRC6A	TTTCA	AD	1	10	FAME6	Ishiura et al (2018) Nature Genetics 50;581-90	29507423
15516	XYLT1	GGC	AR	20	70	DBQD2	LaCroix et al (2018) AJHG 104(1):35-44	30554721
12873	ZIC2	GCN	AD	15	25	HPE5	GeneReviews Internet 2019-11-07	NBK535148
12874	ZIC3	GCN	XR	10	12	VACTERLX	GeneReviews Internet 2019-11-07	NBK535148
9179	POLG	CTG	-	15	10000	-	Research only. Contact CMMS, KUH, regarding findings.	CMMS

Stranger can also read a legacy .tsv format file, structured like a Scout gene panel, with STR specific columns. The column names and keys correspond, but if in any kind of doubt, please read the code or use the json version.

As a default the file that follows the distribution is used but the users can create their own file. Header line(s) should be preceded with a #.

It is also possible to use an ExpansionHunter variant catalog json file with corresponding keys added. E.g.

[
    {
        "VariantType": "Repeat",
        "LocusId": "ATXN2",
        "LocusStructure": "(GCT)*",
        "ReferenceRegion": "chr12:112036753-112036822",
        "Disease": "SCA2",
        "NormalMax": 31,
        "PathologicMin": 39
    },
    {
        "VariantType": "Repeat",
        "LocusId": "PABPN1",
        "LocusStructure": "(GCG)*",
        "ReferenceRegion": "chr14:23790681-23790699",
        "Disease": "OPMD",
        "NormalMax": 6,
        "PathologicMin": 9
    }
]

Such files are also provided with the distribution. PRs with updates are much appreciated.

Output

Output is by annotated VCF, with keys STR_STATUS, NormalMax and PathologicMin.

##INFO=<ID=STR_STATUS,Number=A,Type=String,Description="Repeat expansion status. Alternatives in [normal, pre_mutation, full_mutation]">
4       3076603 .       C       <STR17>,<STR18> .       PASS    END=3076660;REF=19;RL=57;RU=CAG;VARID=HTT;REPID=HTT;STR_STATUS=normal,normal

TRGT mode

The flag --trgt will instruct Stranger to accept TRGT style VCFs. In particular, motif copy numbers are parsed from the GT.MC field and motifs listed in the PathologicStruc entry of the reference catalog:

    {
        "VariantType": "Repeat",
        "LocusId": "RAPGEF2",
        "HGNCId": 16854,
        "InheritanceMode": "AD",
        "DisplayRU": "TTTCA",
        "SourceDisplay": "Ishiura et al (2018) Nature Genetics 50 581-90",
        "Source": "PubMed",
        "SourceId": "29507423",
        "LocusStructure": "(TTTTA)*(TTTCA)*(TTTTA)*",
        "ReferenceRegion": [
            "4:160263679-160263703",
            "4:160263704-160263708",
            "4:160263709-160263768"
        ],
        "VariantType": [
            "Repeat",
            "Repeat",
            "Repeat"
        ],
        "VariantId": [
            "RAPGEF2_TTTTA_5P",
            "RAPGEF2",
            "RAPGEF2_TTTTA_3P"
        ],
        "PathologicRegion": "4:160263704-160263708",
        "PathologicStruc": [1],
        "Disease": "FAME7",
        "NormalMax": 1,
        "PathologicMin": 10
    },

and

...
##FORMAT=<ID=MC,Number=.,Type=String,Description="Motif counts per allele">
...
4	160263680	.	TTTATTTTATTTTATTTTATTTTATATTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	.	0	.	TRID=FAME7_RAPGEF2;END=160263770;MOTIFS=TTTTA,TTTCA;STRUC=(TTTTA)n(TTTCA)n(TTTTA)n;STR_STATUS=full_mutation;STR_NORMAL_MAX=1;STR_PATHOLOGIC_MIN=10;RankScore=internal_id_3:30;HGNCId=16854;InheritanceMode=AD;DisplayRU=TTTCA;SourceDisplay=Ishiura et al (2018) Nature Genetics 50 581-90;Source=PubMed;SourceId=29507423;Disease=FAME7	GT:AL:ALLR:SD:MC:MS:AP:AM	0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.	0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.	0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.
...