This library is a streamlit app for chemical or medical use that show DNA sequences effectively
Project description
Streamlit seqviz
=============================
This library is a streamlit app for chemical or medical use that show DNA sequences effectively based on `seqviz <https://github.com/Lattice-Automation/seqviz>`_ js library.
.. image:: https://gitlab.com/nicolalandro/streamlit-seqviz/-/blob/main/imgs/white_screen.png
:alt: Streamlit app example
.. code-block:: python
from streamlit_seqviz import streamlit_seqviz
streamlit_seqviz(
name = "J23100",
seq = "TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
annotations = [{ "name": "promoter", "start": 0, "end": 30, "direction": 1 }],
style = { "height": "100vh", "width": "100vw" },
highlights = [{ "start": 0, "end": 10 }],
enzymes = [
"EcoRI",
"PstI",
{
"name": "Cas9",
"rseq": "NGG", # recognition sequence
"fcut": 0, # cut index on FWD strand, relative to start of rseq
"rcut": 1, # cut index on REV strand, relative to start of rseq
"color": "#D7E5F0", # color to highlight recognition site with
"range": {
"start": 4,
"end": 8,
},
},
],
)
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
streamlit-seqviz-0.0.1.tar.gz
(3.3 kB
view hashes)