Skip to main content

This library is a streamlit app for chemical or medical use that show DNA sequences effectively

Project description

|huggingface badge|

.. |huggingface badge| image:: https://huggingface.co/datasets/huggingface/badges/raw/refs%2Fpr%2F11/open-in-hf-spaces-md-dark.svg
:target: https://huggingface.co/spaces/z-uo/DNASequenceVisualization


Streamlit seqviz
=============================

This library is a streamlit app for chemical or medical use that show DNA sequences effectively based on `seqviz <https://github.com/Lattice-Automation/seqviz>`_ js library.

.. image:: https://gitlab.com/nicolalandro/streamlit-seqviz/-/blob/main/imgs/white_screen.png
:alt: Streamlit app example

.. code-block:: python

from streamlit_seqviz import streamlit_seqviz

streamlit_seqviz(
name = "J23100",
seq = "TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
annotations = [{ "name": "promoter", "start": 0, "end": 30, "direction": 1 }],
style = { "height": "100vh", "width": "100vw" },
highlights = [{ "start": 0, "end": 10 }],
enzymes = [
"EcoRI",
"PstI",
{
"name": "Cas9",
"rseq": "NGG", # recognition sequence
"fcut": 0, # cut index on FWD strand, relative to start of rseq
"rcut": 1, # cut index on REV strand, relative to start of rseq
"color": "#D7E5F0", # color to highlight recognition site with
"range": {
"start": 4,
"end": 8,
},
},
],
)




Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

streamlit-seqviz-0.0.2.tar.gz (61.0 kB view hashes)

Uploaded Source

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page