Skip to main content

Synbio design and build library

Project description

synbio

synbio is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols

Installation

pip3 install synbio

Models

Designed to have a minimal API, only a few objects are exposed to the user. synbio only expects the user to define their Design and Protocol (list of steps).

  • SeqRecord - BioPython
  • Design
    • Plasmid - single list of SeqRecords to concatenate
    • Combinatorial - list of bins for combinatorial assembly

Example

In the example below, the user specifies a combinatorial library design. Each list (record_bin) appended to the design is another bin of SeqRecords to try concatenating with all other SeqRecords in adjacent bins.

Behind the scenes, synbio is filtering all combinations of SeqRecords from the design that will circularize into valid plasmids (via circuits in a graph). After running the protocol, users can export plate maps (to_csv()), composite plasmids (to_fasta(), to_genbank()), and assembly instructions (to_txt()).

"""Example of a Combinatorial MoClo assembly with steps and output."""

from Bio.SeqIO import parse

from synbio import Protocol
from synbio.composite import MoClo
from synbio.design import Combinatorial

# create a combinatorial library design from multiple "bins"
design = Combinatorial()
records = parse("./moclo_parts.fa", "fasta")
for type in ["promoter", "RBS", "CDS", "terminator"]:
    record_bin = [r for r in records if any(f.type == type for f in r.features)]
    design.append(record_bin)  # add a new cominatorial bin

# create a protocol using MoClo as the sole composite step and run
protocol = Protocol(name="Combinatorial MoClo", design=design)
protocol.add(MoClo())
protocol.run()

# export all the output plasmids to a multi-FASTA
protocol.to_fasta("composite_parts.fasta")

# export plate layouts
protocol.to_csv("combinatorial_moclo.csv")

# export protocol
protocol.to_txt("combinatorial_moclo.txt")

composite_parts.fasta

>J23100_AB|B0032m_BC|C0012m_CD|B0015_DE|DVK_AE
GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
...

combinatorial_moclo.csv

Setup PCR plate with (volumes) shown:
Plate 1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE (4),C0080_CD (18),R0010_AB (54),water (36)
B,B0015_DE (160),DVK_AE (160),cre_CD (18),water (156)
...

combinatorial_moclo.txt

Combinatorial MoClo
1. Setup PCR plate with (volumes) shown:
	1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
	1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

synbio-0.0.3.tar.gz (17.2 kB view hashes)

Uploaded Source

Built Distribution

synbio-0.0.3-py3-none-any.whl (21.6 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page