Synbio design and build library
Project description
synbio
synbio
is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords; output assembly SeqRecords, protocols, plate maps, and robotic picklists.
Installation
pip3 install synbio
Models
Designed to have a minimalist API, synbio
only expects the user to define their Design
and Protocol
(list of steps). Several protocols are pre-defined.
SeqRecord
- BioPythonDesign
Plasmid
- single list of SeqRecords to concatenateCombinatorial
- list of bins for combinatorial assembly
Example
In the example below, the user specifies a combinatorial library design. Each list (record_bin
) appended to the design is another bin of SeqRecords
to try concatenating with all other SeqRecords
in adjacent bins.
Behind the scenes, synbio
is filtering all combinations of SeqRecords
from the design that will circularize into valid plasmids (via circuits in a graph). After running the protocol
, users can export plate maps (to_csv()
), composite plasmids (to_fasta()
, to_genbank()
), and assembly instructions (to_txt()
).
"""Example of a Combinatorial MoClo assembly with steps and output."""
from Bio.SeqIO import parse
from synbio import Protocol
from synbio.composite import MoClo
from synbio.design import Combinatorial
# create a combinatorial library design from multiple "bins"
design = Combinatorial()
records = parse("./moclo_parts.fa", "fasta")
for type in ["promoter", "RBS", "CDS", "terminator"]:
record_bin = [r for r in records if any(f.type == type for f in r.features)]
design.append(record_bin) # add a new cominatorial bin
# create a protocol using MoClo as the sole composite step and run
protocol = Protocol(name="Combinatorial MoClo", design=design)
protocol.add(MoClo())
protocol.run()
# export all the output plasmids to a multi-FASTA
protocol.to_fasta("composite_parts.fasta")
# export plate layouts
protocol.to_csv("combinatorial_moclo.csv")
# export protocol
protocol.to_txt("combinatorial_moclo.txt")
composite_parts.fasta
>J23100_AB|B0032m_BC|C0012m_CD|B0015_DE|DVK_AE
GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
...
combinatorial_moclo.csv
Setup PCR plate with (volumes) shown:
Plate 1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE (4),C0080_CD (18),R0010_AB (54),water (36)
B,B0015_DE (160),DVK_AE (160),cre_CD (18),water (156)
...
combinatorial_moclo.txt
Combinatorial MoClo
1. Setup PCR plate with (volumes) shown:
1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...
Alternatives
This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms.
- Aquarium is an extensive library/application for LIMS, protocol definition/execution, and workflow design.
- Autoprotocol is a specification standard for experiments in the life sciences.
- BioBricks is a general focus, web-based editor for describing experiments in Biology.
- Biocoder is a C++ library with extensive protocol definition capabilities.
- Plateo is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
- pydna is a python DNA assembly simulation library with a human-readable description of cloning and assembly strategies.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.