synbio 0.2.0

Synbio design and build library

synbio

synbio is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords; output assembly SeqRecords, protocols, plate maps, and robotic picklists.

Installation

pip3 install synbio

Models

Designed to have a minimalist API, synbio only expects the user to define their Design and Protocol (list of steps). Several protocols are pre-defined.

• SeqRecord - BioPython
• Design
  • Plasmid - single list of SeqRecords to concatenate
  • Combinatorial - list of bins for combinatorial assembly

Example

In the example below, the user specifies a combinatorial library design. Each list (record_bin) appended to the design is another bin of SeqRecords to try concatenating with all other SeqRecords in adjacent bins.

Behind the scenes, synbio is filtering all combinations of SeqRecords from the design that will circularize into valid plasmids (via circuits in a graph). After running the protocol, users can export plate maps (to_csv()), composite plasmids (to_fasta(), to_genbank()), and assembly instructions (to_txt(), to_picklists()).

"""Example of a Combinatorial Golden Gate assembly with steps and output."""

from Bio.SeqIO import parse

from synbio import Combinatorial, Protocol
from synbio.composite import Golden Gate

# create a combinatorial library design from multiple "bins"
design = Combinatorial()
records = parse("./moclo_parts.fa", "fasta")
for type in ["promoter", "RBS", "CDS", "terminator"]:
    record_bin = [r for r in records if any(f.type == type for f in r.features)]
    design.append(record_bin)  # add a new cominatorial bin

# create a protocol using Golden Gate as the sole composite step and run
protocol = Protocol(name="Combinatorial Golden Gate", design=design)
protocol.add(GoldenGate())
protocol.run()

# export all the output plasmids to a multi-FASTA
protocol.to_fasta("composite_parts.fasta")

# export plate layouts
protocol.to_csv("plate_layouts.csv")

# export human protocol
protocol.to_txt("protocol.txt")

# export a hamilton picklist
protocol.to_picklists("robotic_picklist.gwl", platform="tecan")

composite_parts.fasta

>J23100_AB|B0032m_BC|C0012m_CD|B0015_DE|DVK_AE
GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
...

combinatorial_moclo.csv

Setup PCR plate with (volumes) shown:
Plate 1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE (4),C0080_CD (18),R0010_AB (54),water (36)
B,B0015_DE (160),DVK_AE (160),cre_CD (18),water (156)
...

protocol.txt

Combinatorial GoldenGate
1. Setup PCR plate with (volumes) shown:
	1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
	1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...

robotic_picklist.gwl

A;Plate:2;;;15;;2.0;;;
D;Plate:3;;;80;;2.0;;;
W;;;;;;;;;
...

Alternatives

This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms.

• Aquarium is an extensive library/application for LIMS, protocol definition/execution, and workflow design.
• Autoprotocol is a specification standard for experiments in the life sciences.
• BioBricks is a general focus, web-based editor for describing experiments in Biology.
• Biocoder is a C++ library with extensive protocol definition capabilities.
• Plateo is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
• pydna is a python DNA assembly simulation library with a human-readable description of cloning and assembly strategies.