Synbio design and build library
Project description
synbio
synbio
is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords; output assembly SeqRecords, protocols, plate maps, and robotic picklists.
Installation
pip install synbio
Models
Designed to have a minimalist API, synbio
only expects the user to define their Design
and Protocol
(list of steps). Several protocols are pre-defined.
SeqRecord
- of BioPythonDesign
Plasmid
- single list of SeqRecords to combine into a plasmidCombinatorial
- list of SeqRecords to combine into all valid assembliesCombinatorialBins
- list of bins for combinatorial assembly between bins
Example
In the example below, the user specifies a combinatorial library design. All SeqRecords are tested for circularization with other SeqRecords. New and valid plasmids are assembled.
Behind the scenes, synbio
is filtering all combinations of SeqRecords from the design that will circularize into valid plasmids (via circuits in a graph). After running the protocol
, users can export plate maps (to_csv()
), composite plasmids (to_fasta()
, to_genbank()
), and assembly instructions (to_txt()
, to_picklists()
).
"""Example of a Combinatorial Golden Gate assembly with human and robot output protocols."""
import os
from Bio.SeqIO import parse
from synbio import Combinatorial
from synbio.protocols import GoldenGate
def read_all_records():
"""Gather all SeqRecords from "goldengate" dir in examples."""
GG_DIR = os.path.join(".", "examples", "goldengate")
records = []
for file in os.listdir(GG_DIR):
if file.endswith(".gb"):
records.extend(parse(os.path.join(GG_DIR, file), "genbank"))
return records
# create a combinatorial library design from multiple "bins"
design = Combinatorial(read_all_records())
# create a protocol using Golden Gate as the sole composite step and run
protocol = GoldenGate(
name="CombinatorialBins Golden Gate",
design=design,
resistance="KanR", # only keep circularized plasmids with KanR
min_count=5, # only keep circularized plasmids from >=5 SeqRecords
)
protocol.run()
# export all the output plasmids to a multi-FASTA
protocol.to_fasta("composite_parts.fasta")
# export plate layouts
protocol.to_csv("plate_layouts.csv")
# export human protocol
protocol.to_txt("protocol.txt")
# export a hamilton picklist
protocol.to_picklists("robotic_picklist.gwl", platform="tecan")
composite_parts.fasta
>J23100_AB|B0032m_BC|C0012m_CD|B0015_DE|DVK_AE
GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
...
plate_layouts.csv
Setup PCR plate with (volumes) shown:
Plate 1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE (4),C0080_CD (18),R0010_AB (54),water (36)
B,B0015_DE (160),DVK_AE (160),cre_CD (18),water (156)
...
protocol.txt
Combinatorial GoldenGate
1. Setup PCR plate with (volumes) shown:
1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...
robotic_picklist.gwl
A;Plate:2;;;15;;2.0;;;
D;Plate:3;;;80;;2.0;;;
W;;;;;;;;;
...
Alternatives
This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms and synbio
.
- Aquarium is an extensive library/application for LIMS, protocol definition/execution, and workflow design. A lab operating system.
- Autoprotocol is a specification standard for experiments in the life sciences.
- BioBricks is a general focus, web-based editor for describing experiments in Biology.
- Biocoder is a C++ library with extensive protocol step definition capabilities.
- Plateo is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
- pydna is a python DNA assembly simulation library with a human-readable description of cloning and assembly strategies.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.