This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description
# umis

**Note: This tool works on heuristic counting. For more principled UMI quantification, see [Kallisto](https://github.com/pachterlab/kallisto).**
Some scripts of `umis` might still be useful for pre-processing and investigating UMI data. In particular the regex based UMI extraction.

**umis** provides tools for estimating expression in RNA-Seq data which performs
sequencing of end tags of trancsript, and incorporate molecular tags to
correct for amplification bias.

There are three steps in this process.

1. Formatting reads
2. Pseodomapping to cDNAs
3. Counting molecular identifiers

## 1. Formatting reads

We want to strip out all non-biological segments of the sequenced reads for
the sake of mapping. While also keeping this information for later use. We
consider non-biological information such as Cellular Barcode and Molecular
Barcode. To later be able to extract the optional CB and the MB these are put
in the read header, with the followign format.

@HWI-ST808:130:H0B8YADXX:1:1101:2088:2222:CELL_GGTCCA:UMI_CCCT
AGGAAGATGGAGGAGAGAAGGCGGTGAAAGAGACCTGTAAAAAGCCACCGN
+
@@@DDBD>=AFCF+<cafhdecii:dggghgiggiiiehgiiigiidhii#<br>
The command `umis fastqtransform` is for transforming a (pair of) read(s) to
this format based on a _transform file_. The transform file is a json file
which has a Python flavored regular expression for each read, made to extract
the necessary components of the reads.

## 2. Pseodomapping to cDNAs

This is done by pseduoaligners, either Kallisto or RapMap. The SAM file output
from these tools need to be saved.

## 3. Counting molecular identifiers

The final step is to infer which cDNA was the origin of the tag a UMI was
attached to. We use the pseudoalignments to the cDNAs, and consider a tag
assigned to a cDNA as a partial _evidence_ for a (cDNA, UMI) pairing. For
actual counting, we only count unique UMIs for (gene, UMI) pairings with
sufficient evidence.
Release History

Release History

0.3

This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.2.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.2.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.2.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.1.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
umis-0.3.macosx-10.6-x86_64.tar.gz (17.9 kB) Copy SHA256 Checksum SHA256 3.5 Dumb Binary Aug 16, 2016
umis-0.3.tar.gz (22.1 kB) Copy SHA256 Checksum SHA256 Source Aug 16, 2016

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS HPE HPE Development Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting