unitig-caller 1.2.0

unitig-caller: wrapper around mantis to detect presence of sequence elements

unitig-caller

Determines presence/absence of sequence elements in bacterial sequence data. Uses assemblies and/or reads as inputs.

The implementation of unitig-caller is a wrapper around the Bifrost API which formats files for use with pyseer, as well as an implementation which calls sequences using an FM-index.

Call mode builds a Bifrost DBG and calls the colours for each unitig within. Query mode queries the colours of existing unitigs within a new population.

Simple mode finds presence of unitigs in a new population using an FM-index.

Install

Use unitig-caller if installed through pip/conda, or python unitig_caller-runner.py if using a clone of the code.

With conda (recommended)

Get it from bioconda:

conda install unitig-caller

If you haven't set this up, first install miniconda. Then add the correct channels:

conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge

With pip

Get it from PyPI:

pip install unitig-caller

Requires bifrost version 1.0.3 installed, and accessible via PATH (see steps for installation at Bifrost github page).

From source

Requires cmake, pthreads, pybind11 and a C++17 compiler (e.g. gcc >=7.3), in addition to the pip requirements.

git clone https://github.com/johnlees/unitig-caller --recursive
python setup.py install

Usage

There are three ways to use this package:

1. Build a population graph to extract unitigs for GWAS with pyseer like unitig-counter (--call).
2. Find existing unitigs in a new population using a graph (--query).
3. Find existing unitigs in a new population using an index (--simple).

For 1), run --call mode.

Both 2) and 3) give the same results with different index tools, both finding unitigs so pyseer models can be applied to a new population.

For 2) Run --query mode, specifying new population input fastas file names in a text file (one file per line), with --unitigs from the original population.

For 3), run --simple mode giving the new genomes as --refs and the --unitigs from the original population.

These modes are detailed below

Running Call mode

This uses Bifrost Build to generate a compact coloured de Bruijn graph, and return colours of unitigs within.

If no pre-built Bifrost graph exists

unitig-caller --call --refs refs.txt --reads reads.txt --out out_prefix

--refs and --reads are .txt file listing paths of input ASSEMBLIES and READS respectively (.fasta or .fastq), each on a new line. No header row. Can either specify both or single arguments.

NOTE: ensure reads and references are correctly assigned. Bifrost filters out kmers with coverage < 1 in READS files to remove sequencing errors.

--kmer can be specified for the kmer size used to built the graph. By default this is 31 bp.

If pre-built Bifrost graph exists

unitig-caller --call --graph graph.gfa --colours graph.bfg_colors --out out_prefix

--graph is a pre-built bifrost graph .gfa, and --colours is its associated colours file.

For both call modes

--out is the prefix for output files.

Call mode automatically generates a .pyseer file containing unitigs found within the graph and their graph. Rtab or pyseer formats can be specified with --rtab and --pyseer respectively.

Running Query mode

Queries existing unitigs in a Bifrost graph. This is useful when identical unitig definitions need to be used between populations, for example when using pyseer's prediction mode.

If no pre-built Bifrost graph exists

unitig-caller --query --refs refs.txt --reads reads.txt --unitigs query_unitigs.fasta --out out_prefix

--refs and --reads are the same arguments as in --call.

--kmer can be specified for the kmer size used to built the graph. By default this is 31 bp.

If pre-built Bifrost graph exists

unitig-caller --query --graph graph.gfa --colours graph.bfg_colors --unitigs query_unitigs.fasta --out out_prefix

For both query modes

--unitigs is .fasta file or text file with unitig sequences (one sequence per line, with header line).

--out is the prefix for output files.

Query mode automatically generates a .pyseer file containing unitigs found within the graph and their graph. Rtab or pyseer formats can be specified with --rtab and --pyseer respectively.

Running simple mode

This uses suffix arrays (FM-index) provided by SeqAn3 to perform string matches:

unitig-caller --simple --refs strain_list.txt --unitigs queries.txt --output calls

--refs is a required file listing input assemblies, the same as refs in call.

--unitigs is a required list of the unitig sequences to call. The unitigs need to be in the first column (tab separated). A header row is assumed, so output from pyseer etc can be directly used.

calls_pyseer.txt will contain unitig calls in seer/pyseer k-mer format.

By default FM-indexes are saved in the same location as the assembly files so that they can be quickly loaded by subsequent runs. To turn this off use --no-save-idx.

Option reference

usage: unitig-caller [-h] (--call | --query | --simple) [--refs REFS]
                     [--reads READS] [--graph GRAPH] [--colours COLOURS]
                     [--unitigs UNITIGS] [--pyseer] [--rtab] [--out OUT]
                     [--kmer KMER] [--write-graph]
                     [--no-save-idx] [--threads THREADS] [--version]

Call unitigs in a population dataset

optional arguments:
  -h, --help         show this help message and exit

Mode of operation:
  --call             Build a DBG and call colours of unitigs within
  --query            Query unitig colours in reference genomes/DBG
  --simple           Use FM-index to make calls

Unitig-caller input/output:
  --refs REFS        Ref file to used to build DBG or use with --simple
  --reads READS      Read file to used to build DBG
  --graph GRAPH      Existing graph in GFA format
  --colours COLOURS  Existing bifrost colours file in .bfg_colors format
  --unitigs UNITIGS  Text or fasta file of unitigs to query (--query or --simple)
  --pyseer           Output pyseer format
  --rtab             Output rtab format
  --out OUT          Prefix for output [default = 'unitig_caller']

Bifrost options:
  --kmer KMER        K-mer size for graph building/querying [default = 31]
  --write-graph      Output DBG built with unitig-caller

Simple mode options:
  --no-save-idx      Do not save FM-indexes for reuse

Other:
  --threads THREADS  Number of threads to use [default = 1]
  --version          show program's version number and exit

Interpreting output files

Pyseer format details unitig sequences followed by the file names of the genomes in which they are found.

If a unitig is not found in any genomes, it will have no associated file names.

TATCCAGGCAGGAAAATATACAGGGAACGTTGTGTTTTCGATTAAGTATGAATGATGTAAA | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#29.contigs_velvet:1
GGCTATTGAAGCACCAGAGAATATCCAGGCAGGAAAATATACAGGGAACGT | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#27.contigs_velvet:1 12673_8#29.contigs_velvet:1
CATGGCTATTGAAGCACCAGAGAATATCCAGGC | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#27.contigs_velvet:1 12673_8#28.contigs_velvet:1 12673_8#29.contigs_velvet:1

Rtab format details unitig sequences, along with a presence/absence matrix in each input file (1 present, 0 not).

Unitig_sequence	12673_8#24.contigs_velvet	12673_8#26.contigs_velvet	12673_8#27.contigs_velvet	12673_8#28.contigs_velvet	12673_8#29.contigs_velvet
GGATGCGGATGCCGACGCTGATGCTGACGCC	0	0	1	0	0
AGCATCAGCATCAGCGTCGGCATCCGCATCC	0	0	1	0	0
CGCTGATGCGGATGCCGACGCTGATGCGGAC	1	1	0	0	1

Citation

If you use this, please cite the Bifrost paper:

Holley G., Melsted, P. Bifrost – Highly parallel construction and indexing of colored and compacted de Bruijn graphs. bioRxiv 695338 (2019). doi: https://doi.org/10.1101/695338