unitig-caller
Determines presence/absence of sequence elements in bacterial sequence data. Uses assemblies and/or reads as inputs.
The implementation of unitig-caller is a wrapper around the Bifrost API which formats files for use with pyseer, as well as an implementation which calls sequences using an FM-index.
Call mode builds a Bifrost DBG and calls the colours for each unitig within. Query mode queries the colours of existing unitigs within a new population.
Simple mode finds presence of unitigs in a new population using an FM-index.
Install
Use unitig-caller if installed through pip/conda, or
python unitig_caller-runner.py if using a clone of the code.
With conda (recommended)
Get it from bioconda:
conda install unitig-caller
If you haven't set this up, first install miniconda. Then add the correct channels:
conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge
With pip
Get it from PyPI:
pip install unitig-caller
Requires bifrost version 1.0.3 installed, and accessible via PATH (see steps for installation at Bifrost github page).
From source
Requires cmake, pthreads, pybind11 and a C++17 compiler (e.g. gcc >=7.3), in addition
to the pip requirements.
git clone https://github.com/johnlees/unitig-caller --recursive
python setup.py install
Usage
There are three ways to use this package:
- Build a population graph to extract unitigs for GWAS with pyseer like unitig-counter (
--call). - Find existing unitigs in a new population using a graph (
--query). - Find existing unitigs in a new population using an index (
--simple).
For 1), run --call mode.
Both 2) and 3) give the same results with different index tools, both finding unitigs so pyseer models can be applied to a new population.
For 2) Run --query mode, specifying new population input fastas file names in a text file (one file per line), with --unitigs from the original population.
For 3), run --simple mode giving the new genomes as --refs and the --unitigs from the original population.
These modes are detailed below
Running Call mode
This uses Bifrost Build to generate a compact coloured de Bruijn graph, and return colours of unitigs within.
If no pre-built Bifrost graph exists
unitig-caller --call --refs refs.txt --reads reads.txt --out out_prefix
--refs and --reads are .txt file listing paths of input ASSEMBLIES and READS respectively
(.fasta or .fastq), each on a new line. No header row. Can either specify both or single arguments.
NOTE: ensure reads and references are correctly assigned. Bifrost filters out kmers with coverage < 1 in READS files to remove sequencing errors.
--kmer can be specified for the kmer size used to built the graph. By default this is 31 bp.
If pre-built Bifrost graph exists
unitig-caller --call --graph graph.gfa --colours graph.bfg_colors --out out_prefix
--graph is a pre-built bifrost graph .gfa, and --colours is its associated colours file.
For both call modes
--out is the prefix for output files.
Call mode automatically generates a .pyseer file containing unitigs found within the graph and their graph. Rtab or pyseer
formats can be specified with --rtab and --pyseer respectively.
Running Query mode
Queries existing unitigs in a Bifrost graph. This is useful when identical unitig definitions need to be used between populations, for example when using pyseer's prediction mode.
If no pre-built Bifrost graph exists
unitig-caller --query --refs refs.txt --reads reads.txt --unitigs query_unitigs.fasta --out out_prefix
--refs and --reads are the same arguments as in --call.
--kmer can be specified for the kmer size used to built the graph. By default this is 31 bp.
If pre-built Bifrost graph exists
unitig-caller --query --graph graph.gfa --colours graph.bfg_colors --unitigs query_unitigs.fasta --out out_prefix
For both query modes
--unitigs is .fasta file or text file with unitig sequences (one sequence per line, with header line).
--out is the prefix for output files.
Query mode automatically generates a .pyseer file containing unitigs found within the graph and their graph. Rtab or pyseer
formats can be specified with --rtab and --pyseer respectively.
Running simple mode
This uses suffix arrays (FM-index) provided by SeqAn3 to perform string matches:
unitig-caller --simple --refs strain_list.txt --unitigs queries.txt --output calls
--refs is a required file listing input assemblies, the same as refs in call.
--unitigs is a required list of the unitig sequences to call. The unitigs need
to be in the first column (tab separated). A header row is assumed, so
output from pyseer etc can be directly used.
calls_pyseer.txt will contain unitig calls in seer/pyseer k-mer format.
By default FM-indexes are saved in the same location as the assembly files so that they can
be quickly loaded by subsequent runs. To turn this off use --no-save-idx.
Option reference
usage: unitig-caller [-h] (--call | --query | --simple) [--refs REFS]
[--reads READS] [--graph GRAPH] [--colours COLOURS]
[--unitigs UNITIGS] [--pyseer] [--rtab] [--out OUT]
[--kmer KMER] [--write-graph]
[--no-save-idx] [--threads THREADS] [--version]
Call unitigs in a population dataset
optional arguments:
-h, --help show this help message and exit
Mode of operation:
--call Build a DBG and call colours of unitigs within
--query Query unitig colours in reference genomes/DBG
--simple Use FM-index to make calls
Unitig-caller input/output:
--refs REFS Ref file to used to build DBG or use with --simple
--reads READS Read file to used to build DBG
--graph GRAPH Existing graph in GFA format
--colours COLOURS Existing bifrost colours file in .bfg_colors format
--unitigs UNITIGS Text or fasta file of unitigs to query (--query or --simple)
--pyseer Output pyseer format
--rtab Output rtab format
--out OUT Prefix for output [default = 'unitig_caller']
Bifrost options:
--kmer KMER K-mer size for graph building/querying [default = 31]
--write-graph Output DBG built with unitig-caller
Simple mode options:
--no-save-idx Do not save FM-indexes for reuse
Other:
--threads THREADS Number of threads to use [default = 1]
--version show program's version number and exit
Interpreting output files
Pyseer format details unitig sequences followed by the file names of the genomes in which they are found.
If a unitig is not found in any genomes, it will have no associated file names.
TATCCAGGCAGGAAAATATACAGGGAACGTTGTGTTTTCGATTAAGTATGAATGATGTAAA | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#29.contigs_velvet:1
GGCTATTGAAGCACCAGAGAATATCCAGGCAGGAAAATATACAGGGAACGT | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#27.contigs_velvet:1 12673_8#29.contigs_velvet:1
CATGGCTATTGAAGCACCAGAGAATATCCAGGC | 12673_8#24.contigs_velvet:1 12673_8#26.contigs_velvet:1 12673_8#27.contigs_velvet:1 12673_8#28.contigs_velvet:1 12673_8#29.contigs_velvet:1
Rtab format details unitig sequences, along with a presence/absence matrix in each input file (1 present, 0 not).
Unitig_sequence 12673_8#24.contigs_velvet 12673_8#26.contigs_velvet 12673_8#27.contigs_velvet 12673_8#28.contigs_velvet 12673_8#29.contigs_velvet
GGATGCGGATGCCGACGCTGATGCTGACGCC 0 0 1 0 0
AGCATCAGCATCAGCGTCGGCATCCGCATCC 0 0 1 0 0
CGCTGATGCGGATGCCGACGCTGATGCGGAC 1 1 0 0 1
Citation
If you use this, please cite the Bifrost paper:
Holley G., Melsted, P. Bifrost – Highly parallel construction and indexing of colored and compacted de Bruijn graphs. bioRxiv 695338 (2019). doi: https://doi.org/10.1101/695338
Release files for unitig-caller 1.2.0
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| unitig-caller-1.2.0.tar.gz | 12.2 kB | Details |
Release files / unitig-caller-1.2.0.tar.gz
| Download URL | unitig-caller-1.2.0.tar.gz |
|---|---|
| Size | 12.2 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
ef3c4eda5d41ff88da7813cae13e004ca584a2c4bc5b78e50c66470e7025ae43
|
|
BLAKE2b-256 checksum How to use checksums |
97c03e4ea1e4201874f9961548716951968d27fa2d2b07a5c5b54ca84697a41e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/3.2.0 pkginfo/1.5.0.1 requests/2.25.0 setuptools/46.1.3.post20200325 requests-toolbelt/0.9.1 tqdm/4.50.0 CPython/3.8.2
|