No project description provided
Project description
Python pakcage for genomic variant analysis
variant-effect
command can infer the effect of a mutation
-
-i/--input
to sepecify the input file. The input file has 5 columns:chromosome
,position
,strand
,reference allele
,alternative allele
.- No header is required.
- The 3rd column (strand) is not used by default, just for compatibility with RNA mode.
- By default, the base of reference and alternative allele are based on DNA information
- For RNA mode (through
--rna
argument), the base of reference and alternative allele is reverse complement if the strand is negative(-).
-
-o/--output
to specify the output file, leave empty for stdout. -
-r/--reference
to specify reference name, can be human / mouse / dog / cat / chicken ... -
-t/--type [DNA|RNA]
to run in DNA or RNA mode. If RNA is specified, the ref base will be complemented. -
--all-effects
output all effects of the variant.
demo:
Store the following table in sites.tsv.
chr3 10301112 - G T
chr7 94669540 + G N
chr2 215361150 - A T
chr15 72199549 - G T
chr17 81843580 - C T
chr2 84906537 + C T
chr14 23645352 + G T
chr20 37241351 + G T
chrX 153651037 + G T
chr17 81844010 - A T
Run command variant-effect -i sites.tsv -r human -t RNA
to get the following output.
#chrom pos strand ref alt mut_type gene_name transcript_id transcript_pos transcript_motif coding_pos codon_ref aa_pos aa_ref
chr3 10301112 - C A Silent SEC13 ENST00000397117 1441 TTGATCATCTGCCTTAACGTG 849 CTG 284 L
chr7 94669540 + G N ThreePrimeUTR PEG10 ENST00000612941 6240 TTTTACCCCTGTCAGTAGCCC None None None None
chr2 215361150 - T A ThreePrimeUTR FN1 ENST00000323926 8012 GGCCCGCAATACTGTAGGAAC None None None None
chr15 72199549 - C A ThreePrimeUTR PKM ENST00000319622 2197 GCTGTAACGTGGCACTGGTAG None None None None
chr17 81843580 - G A ThreePrimeUTR P4HB ENST00000681020 3061 AGAAGCTTGTCCCCCGTGTGG None None None None
chr2 84906537 + C T ThreePrimeUTR TMSB10 ENST00000233143 327 CCTGGGCACTCCGCGCCGATG None None None None
chr14 23645352 + G T ThreePrimeUTR DHRS2 ENST00000344777 1391 CTGCCATTCTGCCAGACTAGC None None None None
chr20 37241351 + G T ThreePrimeUTR RPN2 ENST00000237530 1959 AAAACTGAATGTCAAGAAAAG None None None None
chrX 153651037 + G T ThreePrimeUTR DUSP9 ENST00000342782 2145 CTGCTACTTTGGGGGGTGGGG None None None None
chr17 81844010 - T A ThreePrimeUTR P4HB ENST00000681020 2631 GAACTGTAATACGCAAAGCCA None None None None
TODO:
- support GRCh37
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
File details
Details for the file variant-0.0.22.tar.gz
.
File metadata
- Download URL: variant-0.0.22.tar.gz
- Upload date:
- Size: 11.0 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.1.12 CPython/3.10.5 Linux/5.10.16.3-microsoft-standard-WSL2
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | 2c08577e1ae1dab9401c8274b67fc937a1dce7d2bbce8d540f1e6f9f49c02e87 |
|
MD5 | 55389d56b6b0227dc5c7a181e5c6a814 |
|
BLAKE2b-256 | cfd6bc5b06ffd6cc9239053c90e074956dd60dddb29bcb6207119c5507aacbd2 |
File details
Details for the file variant-0.0.22-py3-none-any.whl
.
File metadata
- Download URL: variant-0.0.22-py3-none-any.whl
- Upload date:
- Size: 10.3 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.1.12 CPython/3.10.5 Linux/5.10.16.3-microsoft-standard-WSL2
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | b404db70d8b53fdc67c4649c3a440b23e9ac9b3d80cba73e08fec77a84154a70 |
|
MD5 | 2daf6d3aed191d2a00a77c316e0bc436 |
|
BLAKE2b-256 | 25934f4856ad5110c16702a5e4892e7ede29b0333ae2344a61e91e27b3a00341 |