variant 0.0.53

No project description provided

Python pakcage for genomic variant analysis

How to use?

pip install variant

• run variant-effect in the command line
• more functions will be supported in the future

variant-effect command can infer the effect of a mutation

 Usage: variant-effect [OPTIONS]

 Variant (genomic variant analysis in python)

╭─ Options ────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
│ --input                 -i  TEXT       Input position file.                                                          │
│ --output                -o  TEXT       Output annotation file                                                        │
│ --reference             -r  TEXT       reference species                                                             │
│ --reference-gtf             TEXT       Customized reference gtf file.                                                │
│ --reference-transcript      TEXT       Customized reference transcript fasta file.                                   │
│ --reference-protein         TEXT       Customized reference protein fasta file.                                      │
│ --release               -e  INTEGER    ensembl release                                                               │
│ --type                  -t  [DNA|RNA]  (deprecated)                                                                  │
│ --strandness            -s             Use strand infomation or not?                                                 │
│ --pU-mode               -u             Make rRNA, tRNA, snoRNA into top priority.                                    │
│ --npad                  -n  INTEGER    Number of padding base to call motif.                                         │
│ --all-effects           -a             Output all effects.                                                           │
│ --with-header           -H             With header line in input file.                                               │
│ --columns               -c  TEXT       Sets columns for site info. (Chrom,Pos,Strand,Ref,Alt) [default: 1,2,3,4,5]   │
│ --help                  -h             Show this message and exit.                                                   │
╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯

demo:

Store the following table in file (sites.tsv).

Chrom	Position	Strand	Ref	Alt
chr1	230703034	-	C	T
chr12	69353439	+	A	T
chr14	23645352	+	G	T
chr2	215361150	-	A	T
chr2	84906537	+	C	T
chr22	39319077	-	T	A
chr22	39319095	-	T	A
chr22	39319098	-	T	A

Run command:

variant-effect -i sites.tsv -H -r human -e 108 -t RNA -H -c 1,2,3

• -i specify the input file
• -H means the file is with header line, and the first row will be skipped;
• -r use the specific genome, default is human
• -e specify the Ensembl release version
• -c means only use some of the columns in the input file. default will use the first 5 columns.

You will have this output

Chrom	Position	Strand	Ref	Alt	mut_type	gene_type	gene_name	gene_pos	transcript_name	transcript_pos	transcript_motif	coding_pos	codon_ref	aa_pos	aa_ref	distance2splice
chr1	230703034	-	C	T	ThreePrimeUTR	protein_coding	ENSG00000135744(AGT)	42543	ENST00000680041(AGT-208)	1753	TGTGTCACCCCCAGTCTCCCA	None	None	None	None	295
chr12	69353439	+	A	T	ThreePrimeUTR	protein_coding	ENSG00000090382(LYZ)	5059	ENST00000261267(LYZ-201)	695	TAGAACTAATACTGGTGAAAA	None	None	None	None	286
chr14	23645352	+	G	T	ThreePrimeUTR	protein_coding	ENSG00000100867(DHRS2)	15238	ENST00000344777(DHRS2-202)	1391	CTGCCATTCTGCCAGACTAGC	None	None	None	None	210
chr2	215361150	-	A	T	ThreePrimeUTR	protein_coding	ENSG00000115414(FN1)	74924	ENST00000323926(FN1-201)	8012	GGCCCGCAATACTGTAGGAAC	None	None	None	None	476
chr2	84906537	+	C	T	ThreePrimeUTR	protein_coding	ENSG00000034510(TMSB10)	882	ENST00000233143(TMSB10-201)	327	CCTGGGCACTCCGCGCCGATG	None	None	None	None	148
chr22	39319077	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1313	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None
chr22	39319095	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1295	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None
chr22	39319098	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1292	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None

TODO:

• imporve speed. Base on cgranges, pyranges?, or BioCantor?