zeny-mut 0.0.5

detect mutation in gene and its location

Gene Mutation Detection Package

The Gene Mutation Detection Package is a Python library that allows you to analyze DNA sequences and identify mutations. It provides information about the position of the mutation and prints the mutated region.

Installation:

You can install the package using pip: pip install gene-mutation-detection

Usage:

1. Import the detectMutation function from the package:

from gene_mutation_detection import detectMutation

2. Provide the paths to your original and mutant DNA sequence files

original_fasta_file = 'C:/Users/Dell/Downloads/HEXA_datasets/ncbi_dataset/data/gene.fna'

mutant_fasta_file = 'C:/Users/Dell/Downloads/HEXA_datasets/ncbi_dataset/data/gene-mut.fna'

3. Call the detectMutation function:

mutation_detection_result = detectMutation(original_fasta_file, mutant_fasta_file) print(mutation_detection_result)

Note: you can provide path to original and mutant DNA sequence files in the function directly

Example Output:

If a mutation is detected, the output will be similar to:

Mutation detected in gene NC_000015.10:c72376014-72340924 at position 10920. Mutated region: AAAAAGAGTATTTTTTTTTT

If no mutation is found, it will display:

No mutation detecteted.