Analysis scripts for BFG-Y2H data
Project description
BFG Y2H Analysis Pipeline
Requirements
- Python 3.7
- Bowtie 2 and Bowtie2 build
Files required
The pipeline requires reference files and summary files before running. They can be found on GALEN:
all summary files contain summary of barcode information in csv format for yeast, human and virus
path: /home/rothlab/rli/02_dev/08_bfg_y2h/bfg_data/summary/
all reference files contain all the barcodes in fasta format
path: /home/rothlab/rli/02_dev/08_bfg_y2h/bfg_data/reference/
Before running the pipeline, you need to copy everything in these two folders to your designated directory.
An example sequence in output fasta file:
>G1;YDL169C_BC-1;7;up
CCCTTAGAACCGAGAGTGTGGGTTAAATGGGTGAATTCAGGGATTCACTCCGTTCGTCACTCAATAA
Running the pipeline
-
Install from pypi (recommend):
python -m pip install BFG-Y2H==0.0.1
-
Install and build from github
1. download the package from github
2. inside the root folder, run ./update.sh
- Input arguments:
usage: bfg [-h] [--fastq FASTQ] [--output OUTPUT] --mode MODE [--alignment]
[--cutOff CUTOFF]
BFG-Y2H
optional arguments:
-h, --help show this help message and exit
--fastq FASTQ Path to all fastq files you want to analyze
--output OUTPUT Output path for sam files
--mode MODE pick yeast or human or virus or hedgy
--alignment turn on alignment
--summary path to summary files (default is set to /home/rothlab/rli/02_dev/08_bfg_y2h/bfg_data/summary/)
--ref path to reference files (default is set to /home/rothlab/rli/02_dev/08_bfg_y2h/bfg_data/reference/)
--cutOff CUTOFF assign cut off (default is set to 20)
-
All the input fastq files should have names following the format: y|hADDBGFP(pre|med|high) (for human and yeast)
-
Run the pipeline on GALEN
# this will run the pipeline using slurm
# all the fastq files in the given folder will be processed
# run with alignment
bfg --fastq /path/to/fastq_files/ --output /path/to/output_dir/ --mode yeast/human/virus/hedgy --alignment
# if alignment was finished, you want to only do read counts
bfg --fastq /path/to/fastq_files/ --output /path/to/output_dir/ --mode yeast/human/virus/hedgy
Output files
-
After running the pipeline, one folder will be generated for each group pair (yADDB)
-
The folder called
GALEN_jobs
saves all the bash scripts submited to GALEN -
In the output folder for each group pair, we aligned R1 and R2 separately to the reference sequences for GFP_pre, GFP_med and GFP_high.
-
*_sorted.sam
: Raw sam files generated from bowtie2 -
*_noh.csv
: shrinked sam files, used for scoring -
*_counts.csv
: barcode counts for uptags, dntags, and combined (up+dn)
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.