cvmmlst 0.3.5

python mlst analysis tool

cvmmlst

                                  __     __
  ______   ______ ___  ____ ___  / /____/ /_
 / ___/ | / / __ `__ \/ __ `__ \/ / ___/ __/
/ /__ | |/ / / / / / / / / / / / (__  ) /_
\___/ |___/_/ /_/ /_/_/ /_/ /_/_/____/\__/

cvmmlst is a bacteria mlst analysis tool that could run on Windows, Linux and MAC os. Some of the code ideas in cvmmlst draw on Torsten Seemanns excellent mlst tool.

1. Installation

pip3 install cvmmlst

2. Dependency

• BLAST+ >2.7.0

you should add BLAST in your PATH

3. Blast installation

3.1 Windows

Following this tutorial: Add blast into your windows PATH

3.2 Linux/Mac

The easyest way to install blast is:

conda install -c bioconda blast

4. Introduction

4.1 Initialize reference database

After finish installation, you should first initialize the reference database using following command

cvmmlst init

4.2 Usage

usage: cvmmlst -i <genome assemble directory> -o <output_directory>

Author: Qingpo Cui(SZQ Lab, China Agricultural University)

options:
  -h, --help            show this help message and exit
  -i I                  <input_path>: the PATH to the directory of assembled genome files. Could not use with -f
  -f F                  <input_file>: the PATH of assembled genome file. Could not use with -i
  -o O                  <output_directory>: output PATH
  -scheme SCHEME        <mlst scheme want to use>, cvmmlst show_schemes command could output all available schems
  -minid MINID          <minimum threshold of identity>, default=90
  -mincov MINCOV        <minimum threshold of coverage>, default=60
  -t T                  <number of threads>: default=8
  -v, --version         Display version

cvmmlst subcommand:
  {init,show_schemes,add_scheme}
    init                <initialize the reference database>
    show_schemes        <show the list of all available schemes>
    add_scheme          <add custome scheme, use cvmmlst add_scheme -h for help>

4.3 Show available schemes

cvmmlst show_schemes

4.4 Add custome scheme

usage: cvmmlst -i <genome assemble directory> -o <output_directory>

Author: Qingpo Cui(SZQ Lab, China Agricultural University) add_scheme
       [-h] [-name NAME] [-path PATH]

optional arguments:
  -h, --help  show this help message and exit
  -name NAME  <the custome scheme name>
  -path PATH  <the path to the files of custome scheme>

-name: str -> the scheme name you want to use with -scheme options

-path: str -> the path of the directory that contains the fasta files of locus in schemes and the profile file

Example

cvmmlst add_scheme -name my_scheme -path PATH_TO_my_scheme

The structure of scheme directory should looks like:

own_scheme
├── locus1.fasta
├── locus2.fasta
├── locus3.fasta
├── locus4.fasta
├── locus5.fasta
├── locus6.fasta
├── locus7.fasta
└── own_scheme.txt

The fasta file of corresponding locus is a multifasta file.

The multifasta file looks like:

>locus1_1
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_2
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_3
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_4
ATGATAGGCGAAGATATACAAAGAGTATTAG
>alocus1_5
ATGATAGGCGAAGATATACAAAGAGTATTAG
>locus1_6
ATGATAGGTGAAGATATACAAAGAGTATTAG

The own_scheme.txt is a tab-delimited text file.

The profile looks like:

ST	locus1	locus2	locus3	locus4	locus5	locus6	locus7	clonal_complex
1	2	1	54	3	4	1	5	ST-21 complex
2	4	7	51	4	1	7	1	ST-45 complex
3	3	2	5	10	11	11	6	ST-49 complex
4	10	11	16	7	10	5	7	ST-403 complex
5	7	2	5	2	10	3	6	ST-353 complex
6	63	34	27	33	45	5	7
7	8	10	2	2	14	12	6	ST-354 complex

4.5 Output

you will get a text file and a summray file in csv format in the output directory.

The text file like

dat	bglA	cat	ldh	abcZ	dapE	lhkA	ST	Scheme	FILE
3	1	4	39	12	14	4	87	listeria_2	665

The content in csv summary file like

dat	bglA	cat	ldh	abcZ	dapE	lhkA	ST	Scheme	FILE
3	1	4	39	12	14	4	87	listeria_2	sample01
2	4	4	1	4	3	5	3	listeria_2	sample02
6	6	8	37	7	8	1	121	listeria_2	sample03
3	1	4	39	12	14	4	87	listeria_2	sample04
2	4	4	1	4	3	5	3	listeria_2	sample05
6	6	8	37	7	8	1	121	listeria_2	sample06

5. Update logs

Date	Content
2024-08-12	Add three subcommand (init, show_schems, add_scheme)