evo2-metal
Run ARC Institute's Evo 2 DNA language model on Apple Silicon (Metal GPU) — no CUDA required.
Evo 2 is a 7B–40B parameter genomic foundation model trained on 9.3 trillion DNA tokens. This package makes the 7B models fully usable on a Mac with M-series chips.
How it works
Evo 2 depends on flash-attn, which requires NVIDIA CUDA and does not run on Mac. This package provides:
- A FlashAttention v2 kernel written in Metal Shading Language (Apple's GPU compute API), dispatched via PyObjC.
- A set of monkey-patches applied before importing
evo2that redirect all CUDA-dependent calls to CPU/Metal equivalents — without modifying the original Evo 2 source code.
import evo2_metal ← patches flash_attn, vortex, and evo2.scoring
from evo2 import Evo2
Installation
Requires: macOS with Apple Silicon (M1/M2/M3/M4/M5), Python 3.11 or 3.12.
# 1. Create a Python 3.12 environment (evo2 requires <3.13)
conda create -n evo2-mac python=3.12
conda activate evo2-mac
# 2. Install PyTorch (CPU build for Mac)
pip install torch --index-url https://download.pytorch.org/whl/cpu
# 3. Install evo2-metal (PyPI)
pip install evo2-metal
# Alternative: install directly from GitHub
# pip install git+https://github.com/lemonardo1/evo2-metal.git
Usage
Sequence scoring
import evo2_metal # must be first
from evo2 import Evo2
model = Evo2('evo2_7b_base')
scores = model.score_sequences([
"ATGAAAGCAATTTTCGTACTGAAAGGTTCAGGT", # wildtype
"ATGAAAGCAATTTTCGTACTGAAAGGTTCAGGA", # variant
])
print(scores) # [np.float32(-1.27), np.float32(-1.43)]
DNA sequence generation
import evo2_metal
from evo2 import Evo2
model = Evo2('evo2_7b_base')
output = model.generate(
prompt_seqs=["ATGAAAGCAATTTTCGTACTGAAAGGTTCAGGT"],
n_tokens=200,
temperature=1.0,
top_k=4,
)
print(output.sequences[0])
Supported models
| Model | Parameters | Context | Supported |
|---|---|---|---|
evo2_7b_base |
7B | 8K | ✅ |
evo2_7b |
7B | 1M | ✅ |
evo2_7b_262k |
7B | 262K | ✅ |
evo2_7b_microviridae |
7B | 8K | ✅ |
evo2_1b_base |
1B | 8K | ❌ (requires FP8/Transformer Engine) |
evo2_40b / evo2_20b |
40B / 20B | 1M | ❌ (requires multi-GPU) |
Patches applied
| Patch | Reason |
|---|---|
torch.cuda.device → no-op for cpu |
StripedHyena.__init__ calls torch.cuda.device("cpu") |
torch.cuda.memory_allocated → returns 0 |
Called in generation loop for logging |
flash_attn_2_cuda → mocked |
Not available on Mac |
FlashSelfAttention.forward → Metal backend |
assert qkv.is_cuda fails on CPU |
FlashCrossAttention.forward → Metal backend |
Same |
local_flash_attn_with_kvcache → PyTorch SDPA |
KV-cache path during token generation |
vortex.generation.generate → device='cpu' |
Default was 'cuda:0' |
evo2.scoring.prepare_batch → device='cpu' |
Default was 'cuda:0' |
Verified on
- Apple M5 Max, macOS 15 (Sequoia)
- Python 3.12, PyTorch 2.11, evo2 0.5.3
License
Apache 2.0 — see LICENSE.
Evo 2 model weights are released under their own license by ARC Institute. See the Evo 2 repository for details.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file evo2_metal-0.1.0.tar.gz.
File metadata
- Download URL: evo2_metal-0.1.0.tar.gz
- Upload date:
- Size: 18.6 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.2.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
4a6a54f23466400dd5b122c6374d2288cfd1a61616ce805034e34e1c3d1e7c52
|
|
| MD5 |
b3509214559f0e65edc61b8c9e7a09c8
|
|
| BLAKE2b-256 |
fc63888a85ed1a61a7dec785363e43de155a3638599918e03575bfa0fe179555
|
File details
Details for the file evo2_metal-0.1.0-py3-none-any.whl.
File metadata
- Download URL: evo2_metal-0.1.0-py3-none-any.whl
- Upload date:
- Size: 17.9 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.2.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
9a329882b31efca523ef7fd59502f76da0f4817e1ecd70f27a7c7ef40d1f527f
|
|
| MD5 |
d4a6681262eff65ce89759173c43ec6a
|
|
| BLAKE2b-256 |
56947fcab44dbefb714739ae4b4ee9077d5149ad367e03467053e4a1d1dfa04a
|