geneGet
Installation
Using git:
git clone https://github.com/Ulises-Rosas/geneTable.git
cd geneTable
python3 setup.py install
Usage
getFeatures
Get gene availability and plot it (i.e. -p).
getFeatures "Alopias vulpinus" -p
Filnames are composed by using species name as well as its title by default. Horizontal line depicts three sequences. If there were more than 200 hundred NCBI ids per species, the number of downloaded tables per species is controled with the argument --cache.
lookgenomes
Look at genome metadata
lookgenomes Clupeiformes
accession seq_length conting_n50 sci_name ass_level
GCA_007927625.1 812159898 1632759 Coilia nasus Chromosome
GCF_900700415.1 725670187 1151065 Clupea harengus Chromosome
GCA_900700415.1 725670187 1151065 Clupea harengus Chromosome
GCA_902175115.3 790426535 22496 Clupea harengus Scaffold
GCA_900323705.1 789621745 28410 Clupea harengus Scaffold
GCA_000966335.1 807695261 22277 Clupea harengus Scaffold
GCA_900499035.1 949617276 9398 Sardina pilchardus Scaffold
GCA_003604335.1 641491539 10878 Sardina pilchardus Scaffold
GCA_003651195.1 815647530 129889 Tenualosa ilisha Scaffold
GCA_004329175.1 710279582 1092 Tenualosa ilisha Scaffold
GCF_900700375.1 567401054 3059612 Denticeps clupeoides Chromosome
GCA_900700375.2 567401054 3059612 Denticeps clupeoides Chromosome
GCA_900700375.1 567401054 3059612 Denticeps clupeoides Chromosome
GCA_900700345.2 457704509 384267 Denticeps clupeoides Scaffold
looksra
Look at SRA metadata
looksra Argentiniformes
accession total_bases layout species_name platform is_public lib_strategy lib_source
SRR11679483 1676957378 paired Argentina silus Illumina HiSeq 4000 true WGS GENOMIC
SRR11537143 2577408128 paired Argentina sphyraena Illumina HiSeq 4000 true WGS GENOMIC
ERR3332509 26274979990 paired Opisthoproctus soleatus Illumina HiSeq X Ten true WGS GENOMIC
ERR3332508 26507370802 paired Opisthoproctus soleatus Illumina HiSeq X Ten true WGS GENOMIC
ERR3332507 32283025068 paired Opisthoproctus soleatus Illumina HiSeq X Ten true WGS GENOMIC
ERR3332506 25164048528 paired Opisthoproctus soleatus Illumina HiSeq X Ten true WGS GENOMIC
SRR5997680 4591698120 paired Argentina sp. CUR14063.G Illumina HiSeq 2000 true RNA-Seq TRANSCRIPTOMIC
getgenomes
Get genomes with a file containing accession codes and species names. For example, given the following file listacc.txt :
cat listacc.txt
GCF_001319825.1,Yersinia wautersii
GCF_000493475.1,Yersinia wautersii
We can get genomes from that file by using:
getgenomes listAcc.txt
head Yersinia_wautersii__GCF_001319825.1/GCF_001319825.1_5139_1_1_genomic.fna
>NZ_CVMG01000001.1 Yersinia wautersii strain WP-931201, whole genome shotgun sequence
ATGGCCCACGGTGGAAAACTGGCCACAGGTTGAGTTGCCGGAACTGCCGCAATGGCTTTTGATTGAAGCGGTCAATCAGG
GTTATATTGTTCCCGACTGGCCGCCAGTCGTATAGGCCTGCCCAACAACCCCTCCAGTCGGGGTTGTTGGTTTCTCTGTT
GTGCCACCCCCCACACAATCCTCATCACCTGCCCCGCGCGCAGTAATCCGGCATCATAGCGAATGAACGCTTAACCGGAG
AAAAACGCATGTCTGCAACCGATTACCACCACGGTGTGCGCGTCATTGAAATCAGCGAAGGCACTCGCCCGATCCGCACT
GTCAGTACGGCGGTAGTCGGGATGGTCTGTACTTCCGATGATGCTGACCCCACTCTGTTCCCACTCAATACCCCGGTATT
ACTCACCGATGTGCTGGCCGCCAGCGGCAAGGCCGGTGAAACCGGCACATTAGCCCATTCACTGGATGCTATCAGCGACC
AAACCAAGCCCGTGACTATTGTTGTCCGCGTGGCTCAGGGGGAAACCGAAGCCGAAACTACCTCCAATATTATCGGCGGC
TCCACGCCAGATGGCCGTTATACCGGCATGAAAGCGCTGTTAGCGGCGCAGGGTAAGTTTGACGTCAAGCCCCGTATTTT
AGGGGTGCCCGGTCATGACACTCTGGCGGTATCCACTGAGCTACTTTCCATCGCTCAGAGCCTACGTGCCTTTGCCTACA
1 maintainer
Metadata
1 maintainer
Release files for genetable 0.3
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | Provenance | |
|---|---|---|---|---|
| genetable-0.3.tar.gz | 11.4 kB | Without provenance | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| genetable-0.3-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 27.5 kB
Release files / genetable-0.3.tar.gz
| Download URL | genetable-0.3.tar.gz |
|---|---|
| Size | 11.4 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
7c43dbb0e440a85e6ca1c6f2b2e4ac823ffc0c7cd073b91a25346d2d98f5014f
|
|
BLAKE2b-256 checksum How to use checksums |
fd78650925b6c71c0dbe27265da9b53aac37bde63d45c017bbec6a0afa285914
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/3.2.0 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.4.0.post20200518 requests-toolbelt/0.9.1 tqdm/4.46.0 CPython/3.7.7
|
Release files / genetable-0.3-py3-none-any.whl
| Download URL | genetable-0.3-py3-none-any.whl |
|---|---|
| Size | 16.1 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
7da6615e18dc0b0d77cfe300cb031691523219e2d67ffc120537b5b93f2a219f
|
|
BLAKE2b-256 checksum How to use checksums |
1b61785b87e20b2f3bc12f3b03974924158a3f994116f3caa3464dda2429153a
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/3.2.0 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.4.0.post20200518 requests-toolbelt/0.9.1 tqdm/4.46.0 CPython/3.7.7
|
Security for genetable 0.3
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
No provenance found
None of the files in this release were uploaded with provenance metadata.
A note on package security
PyPI is a repository for distributing packages, not a service for auditing them. While third-party security researchers and our staff do their best to detect and remove malicious packages, PyPI cannot guarantee the quality, security or suitability of any given package.
To learn more about protecting yourself from malicious actors, visit our package security documentation.
