Skip to main content

geneGet

Installation

Using git:

git clone https://github.com/Ulises-Rosas/geneTable.git
cd geneTable
python3 setup.py install

Usage

getFeatures

Get gene availability and plot it (i.e. -p).

getFeatures "Alopias vulpinus" -p

Filnames are composed by using species name as well as its title by default. Horizontal line depicts three sequences. If there were more than 200 hundred NCBI ids per species, the number of downloaded tables per species is controled with the argument --cache.

lookgenomes

Look at genome metadata

lookgenomes Clupeiformes
accession       seq_length      conting_n50     sci_name        ass_level
GCA_007927625.1 812159898       1632759 Coilia nasus    Chromosome
GCF_900700415.1 725670187       1151065 Clupea harengus Chromosome
GCA_900700415.1 725670187       1151065 Clupea harengus Chromosome
GCA_902175115.3 790426535       22496   Clupea harengus Scaffold
GCA_900323705.1 789621745       28410   Clupea harengus Scaffold
GCA_000966335.1 807695261       22277   Clupea harengus Scaffold
GCA_900499035.1 949617276       9398    Sardina pilchardus      Scaffold
GCA_003604335.1 641491539       10878   Sardina pilchardus      Scaffold
GCA_003651195.1 815647530       129889  Tenualosa ilisha        Scaffold
GCA_004329175.1 710279582       1092    Tenualosa ilisha        Scaffold
GCF_900700375.1 567401054       3059612 Denticeps clupeoides    Chromosome
GCA_900700375.2 567401054       3059612 Denticeps clupeoides    Chromosome
GCA_900700375.1 567401054       3059612 Denticeps clupeoides    Chromosome
GCA_900700345.2 457704509       384267  Denticeps clupeoides    Scaffold

looksra

Look at SRA metadata

looksra Argentiniformes
accession       total_bases     layout  species_name    platform        is_public       lib_strategy    lib_source
SRR11679483     1676957378      paired  Argentina silus Illumina HiSeq 4000     true    WGS     GENOMIC
SRR11537143     2577408128      paired  Argentina sphyraena     Illumina HiSeq 4000     true    WGS     GENOMIC
ERR3332509      26274979990     paired  Opisthoproctus soleatus Illumina HiSeq X Ten    true    WGS     GENOMIC
ERR3332508      26507370802     paired  Opisthoproctus soleatus Illumina HiSeq X Ten    true    WGS     GENOMIC
ERR3332507      32283025068     paired  Opisthoproctus soleatus Illumina HiSeq X Ten    true    WGS     GENOMIC
ERR3332506      25164048528     paired  Opisthoproctus soleatus Illumina HiSeq X Ten    true    WGS     GENOMIC
SRR5997680      4591698120      paired  Argentina sp. CUR14063.G        Illumina HiSeq 2000     true    RNA-Seq TRANSCRIPTOMIC

getgenomes

Get genomes with a file containing accession codes and species names. For example, given the following file listacc.txt :

cat listacc.txt
GCF_001319825.1,Yersinia wautersii
GCF_000493475.1,Yersinia wautersii

We can get genomes from that file by using:

getgenomes listAcc.txt 

head Yersinia_wautersii__GCF_001319825.1/GCF_001319825.1_5139_1_1_genomic.fna
>NZ_CVMG01000001.1 Yersinia wautersii strain WP-931201, whole genome shotgun sequence
ATGGCCCACGGTGGAAAACTGGCCACAGGTTGAGTTGCCGGAACTGCCGCAATGGCTTTTGATTGAAGCGGTCAATCAGG
GTTATATTGTTCCCGACTGGCCGCCAGTCGTATAGGCCTGCCCAACAACCCCTCCAGTCGGGGTTGTTGGTTTCTCTGTT
GTGCCACCCCCCACACAATCCTCATCACCTGCCCCGCGCGCAGTAATCCGGCATCATAGCGAATGAACGCTTAACCGGAG
AAAAACGCATGTCTGCAACCGATTACCACCACGGTGTGCGCGTCATTGAAATCAGCGAAGGCACTCGCCCGATCCGCACT
GTCAGTACGGCGGTAGTCGGGATGGTCTGTACTTCCGATGATGCTGACCCCACTCTGTTCCCACTCAATACCCCGGTATT
ACTCACCGATGTGCTGGCCGCCAGCGGCAAGGCCGGTGAAACCGGCACATTAGCCCATTCACTGGATGCTATCAGCGACC
AAACCAAGCCCGTGACTATTGTTGTCCGCGTGGCTCAGGGGGAAACCGAAGCCGAAACTACCTCCAATATTATCGGCGGC
TCCACGCCAGATGGCCGTTATACCGGCATGAAAGCGCTGTTAGCGGCGCAGGGTAAGTTTGACGTCAAGCCCCGTATTTT
AGGGGTGCCCGGTCATGACACTCTGGCGGTATCCACTGAGCTACTTTCCATCGCTCAGAGCCTACGTGCCTTTGCCTACA

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

genetable-0.3.tar.gz (11.4 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

genetable-0.3-py3-none-any.whl (16.1 kB view details)

Uploaded Python 3

File details

Details for the file genetable-0.3.tar.gz.

File metadata

  • Download URL: genetable-0.3.tar.gz
  • Upload date:
  • Size: 11.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.2.0 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.4.0.post20200518 requests-toolbelt/0.9.1 tqdm/4.46.0 CPython/3.7.7

File hashes

Hashes for genetable-0.3.tar.gz
Algorithm Hash digest
SHA256 7c43dbb0e440a85e6ca1c6f2b2e4ac823ffc0c7cd073b91a25346d2d98f5014f
MD5 ae1687a7dd21cd906b1c29e48d1f5398
BLAKE2b-256 fd78650925b6c71c0dbe27265da9b53aac37bde63d45c017bbec6a0afa285914

See more details on using hashes here.

File details

Details for the file genetable-0.3-py3-none-any.whl.

File metadata

  • Download URL: genetable-0.3-py3-none-any.whl
  • Upload date:
  • Size: 16.1 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.2.0 pkginfo/1.5.0.1 requests/2.23.0 setuptools/46.4.0.post20200518 requests-toolbelt/0.9.1 tqdm/4.46.0 CPython/3.7.7

File hashes

Hashes for genetable-0.3-py3-none-any.whl
Algorithm Hash digest
SHA256 7da6615e18dc0b0d77cfe300cb031691523219e2d67ffc120537b5b93f2a219f
MD5 70cae8b0cd6e30ab4811a797b52f6b5c
BLAKE2b-256 1b61785b87e20b2f3bc12f3b03974924158a3f994116f3caa3464dda2429153a

See more details on using hashes here.

Release history Release notifications | RSS feed

0.6

2 files

0.5

2 files

This release

0.3 This release

2 files

0.2

2 files

0.1

1 file

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page