Skip to main content

Pairwise Agreement-based RNA Scoring with Emphasis on Base Pairings

Project description

PARSEbp: Pairwise Agreement-based RNA Scoring with Emphasis on Base Pairings

by Sumit Tarafder and Debswapna Bhattacharya

Codebase for our Pairwise Agreement-based RNA Scoring with Emphasis on Base Pairings (PARSEbp).

Installation

pip install PARSEbp

Or

git clone https://github.com/Bhattacharya-Lab/PARSEbp.git
cd PARSEbp
pip install .

Typical installation time should take less than a minute in a 64-bit Linux system.

Usage

Instructions for running PARSEbp:

# Import
from PARSEbp import parsebp

# Initialize
p = parsebp()

# Set target sequence to "" for sequence-agnostic scoring
p.set_target_sequnece("")

# Load a directory containing RNA 3D structures (.pdb files)
p.load_structures("Inputs/")

# Compute scores
score = p.score()

# Save the results
score.save("score.txt")

Additional functionality

# Set scoring mode (default is 1)
p.set_mode(1)

# Set target sequence (only the models that exactly match the target sequence will be scored)
seq = "GGACACGAGUAACUCGUCUAUCUGCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGAACAUCUAGGUUUCGUCCGGGUGUUACCGAAAGGUCAGAUGGAGAGCCUUGUCCC"
p.set_target_sequnece(seq)

# Set the number of threads for parallel computations (default is 50)
p.set_parallel_threads(50)

# Get score of a specific model
score.getScore("decoy_1.pdb")

# Get top-1 ranked model(s)
score.top1()

# Get top-N ranked decoys
score.topN(10)

Given a directory containing RNA 3D structures "Inputs" as input, PARSEbp predicts the quality score of each structure in the directory and saves the output in "Score.txt".

Score calculation for a typical RNA (~100 nucleotides) with ~200 3D structures takes ~30 seconds.

Detailed Instructions

Follow the provided notebook for detailed explanation of the installation, scoring and score analysis.

Datasets

  • CASP16 3D decoy structures (all submitted predictions) are downloaded from here.
  • Ground truth scores for benchmarking PARSEbp is downloaded from here

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

parsebp-0.1.1.tar.gz (4.4 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

parsebp-0.1.1-py3-none-any.whl (4.2 MB view details)

Uploaded Python 3

File details

Details for the file parsebp-0.1.1.tar.gz.

File metadata

  • Download URL: parsebp-0.1.1.tar.gz
  • Upload date:
  • Size: 4.4 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.10.8

File hashes

Hashes for parsebp-0.1.1.tar.gz
Algorithm Hash digest
SHA256 8a00f77b5e19c97e90b2c7885fe31fb0cd034776fe03fbbe904739aa91deb594
MD5 54f6b256c32c7ad57e8b741717b20925
BLAKE2b-256 46a9dfcb90a3eafc6d0c2b1dc5a35d5b6db1e3e4283a3ab6b0c528a4c78f7a13

See more details on using hashes here.

File details

Details for the file parsebp-0.1.1-py3-none-any.whl.

File metadata

  • Download URL: parsebp-0.1.1-py3-none-any.whl
  • Upload date:
  • Size: 4.2 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.10.8

File hashes

Hashes for parsebp-0.1.1-py3-none-any.whl
Algorithm Hash digest
SHA256 c58f5deddb3ebd9987c1b8634e206af010ea64d22bbab446a6ca03658acde68a
MD5 54afd13ba104a85dee6fc1d7ea0f8b94
BLAKE2b-256 d8605819190608c256a244455095f042999e9cdee1a6256aa3dd392840bf226a

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page