Skip to main content

prairiedog

.daisy.png https://circleci.com/gh/superphy/prairiedog.svg?style=svg https://codecov.io/gh/superphy/prairiedog/branch/master/graph/badge.svg

Supports Python 3.6, Python 3.7, PyPy 3.6 on Linux

Installation

We recommend you follow both the installation step for graph creation and for querying the graph, unless you are computing the graph in one place, and querying it in another.

Both steps require you to first install lemongraph.

Clone prairiedog and install lemongraph

git clone --recursive https://github.com/superphy/prairiedog.git
cd prairiedog/
python3 -m venv venv
. venv/bin/activate
cd lemongraph/
apt-get install libffi-dev zlib1g-dev python-dev python-cffi
python setup.py install

For creating a graph

. venv/bin/activate
pip install -r requirements.txt
pip install snakemake

For querying an existing graph

. venv/bin/activate
python setup.py install

Usage

Docker

docker run -v /abs-path-to/outputs/:/p/outputs/ -v /abs-path-to/samples/:/p/samples/ superphy/prairiedog dgraph

For creating a graph

. venv/bin/activate
snakemake -j 24 --config samples=samples/

For querying an existing graph

Via docker

# Without debug
docker run -v /home/kevin/pdg-test/outputs:/p/outputs/ -v /home/kevin/pdg-test/samples:/p/samples/ superphy/prairiedog:c6ff5c63779a73de02c9b3de0f4225b29564f285 query TCGAGCATTAT GCATAGGCAAC
# With debug
docker run -v /home/kevin/pdg-test/outputs:/p/outputs/ -v /home/kevin/pdg-test/samples:/p/samples/ superphy/prairiedog:c6ff5c63779a73de02c9b3de0f4225b29564f285 --debug query TCGAGCATTAT GCATAGGCAAC

or virtualenv

. venv/bin/activate
prairiedog ATACGACGCCA CGTCCGGACGT

You should get something like:

prairiedog GGGCGTTAAGT GGCAGGTTGAA
prairiedog[21238] INFO Looking for all strings between GGGCGTTAAGT and GGCAGGTTGAA ...
prairiedog[21238] INFO Found {'string': 'GGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAA', 'edge_type': 'SRR3295769.fasta', 'edge_value': '>SRR3295769.fasta|NODE_75_length_556_cov_349.837_ID_5290_pilon'}
prairiedog[21238] INFO Found {'string': 'GGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAA', 'edge_type': 'SRR3665189.fasta', 'edge_value': '>SRR3665189.fasta|NODE_60_length_523_cov_287.621_ID_4672'}

Tests & Benchmarks

Test genomes are included in the tests/ folders, while genomes for benchmarking should be included in the samples/ folder. To run tests and benchmarks:

python3 -m venv venv
. venv/bin/activate
pip install tox
tox -v

History

0.2.0 (2019-07-28)

  • Pangenome graph creation via Dgraph

  • Queries between kmers via Dgraph

0.1.2 (2019-06-21)

  • Supports Pangenome graph creation

  • Uses LemonGraph as backend

  • Supports queries between any two kmers

0.1.1 (2019-05-25)

  • Initial Snakefile for creating graphs

  • Still need to add node_labels

0.1.0 (2019-05-08)

  • First release on PyPI.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

prairiedog-0.2.0.tar.gz (4.8 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

prairiedog-0.2.0-py2.py3-none-any.whl (27.9 kB view details)

Uploaded Python 2Python 3

File details

Details for the file prairiedog-0.2.0.tar.gz.

File metadata

  • Download URL: prairiedog-0.2.0.tar.gz
  • Upload date:
  • Size: 4.8 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/1.12.1 pkginfo/1.5.0.1 requests/2.22.0 setuptools/40.8.0 requests-toolbelt/0.9.1 tqdm/4.32.1 CPython/3.7.3

File hashes

Hashes for prairiedog-0.2.0.tar.gz
Algorithm Hash digest
SHA256 6eaecfc8cbb35d127ad4fe548f9c317eb339384df41edafb26bbe24a5df9d4cc
MD5 bc879c78920998fe25e7bd0e8aed0071
BLAKE2b-256 9cd9477ca56bd18877e957dee0a6935d542ee4f99918cf87c52208b34b605dec

See more details on using hashes here.

File details

Details for the file prairiedog-0.2.0-py2.py3-none-any.whl.

File metadata

  • Download URL: prairiedog-0.2.0-py2.py3-none-any.whl
  • Upload date:
  • Size: 27.9 kB
  • Tags: Python 2, Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/1.12.1 pkginfo/1.5.0.1 requests/2.22.0 setuptools/40.8.0 requests-toolbelt/0.9.1 tqdm/4.32.1 CPython/3.7.3

File hashes

Hashes for prairiedog-0.2.0-py2.py3-none-any.whl
Algorithm Hash digest
SHA256 8eed8039e702d6995419c3cbf3a989b220befb75cf33be62ea1e786334b5ac54
MD5 27ada24278323056ba1d4bead18f02ea
BLAKE2b-256 1ef287776083c03cf648a43e21acef9cf4c61ee9aecb27697544cb4444e4a56e

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.2.0 This release

2 files

0.1.0

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page