prairiedog
Supports Python 3.6, Python 3.7, PyPy 3.6 on Linux
Installation
We recommend you follow both the installation step for graph creation and for querying the graph, unless you are computing the graph in one place, and querying it in another.
Both steps require you to first install lemongraph.
Clone prairiedog and install lemongraph
git clone --recursive https://github.com/superphy/prairiedog.git cd prairiedog/ python3 -m venv venv . venv/bin/activate cd lemongraph/ apt-get install libffi-dev zlib1g-dev python-dev python-cffi python setup.py install
For creating a graph
. venv/bin/activate pip install -r requirements.txt pip install snakemake
For querying an existing graph
. venv/bin/activate python setup.py install
Usage
Docker
docker run -v /abs-path-to/outputs/:/p/outputs/ -v /abs-path-to/samples/:/p/samples/ superphy/prairiedog dgraph
For creating a graph
. venv/bin/activate snakemake -j 24 --config samples=samples/
For querying an existing graph
Via docker
# Without debug docker run -v /home/kevin/pdg-test/outputs:/p/outputs/ -v /home/kevin/pdg-test/samples:/p/samples/ superphy/prairiedog:c6ff5c63779a73de02c9b3de0f4225b29564f285 query TCGAGCATTAT GCATAGGCAAC # With debug docker run -v /home/kevin/pdg-test/outputs:/p/outputs/ -v /home/kevin/pdg-test/samples:/p/samples/ superphy/prairiedog:c6ff5c63779a73de02c9b3de0f4225b29564f285 --debug query TCGAGCATTAT GCATAGGCAAC
or virtualenv
. venv/bin/activate prairiedog ATACGACGCCA CGTCCGGACGT
You should get something like:
prairiedog GGGCGTTAAGT GGCAGGTTGAA
prairiedog[21238] INFO Looking for all strings between GGGCGTTAAGT and GGCAGGTTGAA ...
prairiedog[21238] INFO Found {'string': 'GGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAA', 'edge_type': 'SRR3295769.fasta', 'edge_value': '>SRR3295769.fasta|NODE_75_length_556_cov_349.837_ID_5290_pilon'}
prairiedog[21238] INFO Found {'string': 'GGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAA', 'edge_type': 'SRR3665189.fasta', 'edge_value': '>SRR3665189.fasta|NODE_60_length_523_cov_287.621_ID_4672'}
Tests & Benchmarks
Test genomes are included in the tests/ folders, while genomes for benchmarking should be included in the samples/ folder. To run tests and benchmarks:
python3 -m venv venv . venv/bin/activate pip install tox tox -v
History
0.2.0 (2019-07-28)
Pangenome graph creation via Dgraph
Queries between kmers via Dgraph
0.1.2 (2019-06-21)
Supports Pangenome graph creation
Uses LemonGraph as backend
Supports queries between any two kmers
0.1.1 (2019-05-25)
Initial Snakefile for creating graphs
Still need to add node_labels
0.1.0 (2019-05-08)
First release on PyPI.
Release files for prairiedog 0.2.0
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| prairiedog-0.2.0.tar.gz | 4.8 MB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| prairiedog-0.2.0-py2.py3-none-any.whl | Python 2, Python 3 | none | any | Details |
Total release size: 4.8 MB
Release files / prairiedog-0.2.0.tar.gz
| Download URL | prairiedog-0.2.0.tar.gz |
|---|---|
| Size | 4.8 MB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
6eaecfc8cbb35d127ad4fe548f9c317eb339384df41edafb26bbe24a5df9d4cc
|
|
BLAKE2b-256 checksum How to use checksums |
9cd9477ca56bd18877e957dee0a6935d542ee4f99918cf87c52208b34b605dec
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.12.1 pkginfo/1.5.0.1 requests/2.22.0 setuptools/40.8.0 requests-toolbelt/0.9.1 tqdm/4.32.1 CPython/3.7.3
|
Release files / prairiedog-0.2.0-py2.py3-none-any.whl
| Download URL | prairiedog-0.2.0-py2.py3-none-any.whl |
|---|---|
| Size | 27.9 kB |
| Tags | Python 2 Python 3 |
|
SHA-256 checksum How to use checksums |
8eed8039e702d6995419c3cbf3a989b220befb75cf33be62ea1e786334b5ac54
|
|
BLAKE2b-256 checksum How to use checksums |
1ef287776083c03cf648a43e21acef9cf4c61ee9aecb27697544cb4444e4a56e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.12.1 pkginfo/1.5.0.1 requests/2.22.0 setuptools/40.8.0 requests-toolbelt/0.9.1 tqdm/4.32.1 CPython/3.7.3
|