Skip to main content

PyBioQuanta

PyBioQuanta is a lightweight Python package offering 6 essential bioinformatics utilities.
It is designed for quick sequence operations, small analyses, and everyday bioinformatics tasks.


Features

  • FASTA Reader: Parse FASTA files into Python dictionaries.
  • Reverse Complement: Get the reverse complement of DNA or RNA sequences.
  • DNA Translator: Translate DNA sequences into protein.
  • GC Content Calculator: Calculate GC percentage of a sequence.
  • Motif Finder: Find positions of motifs (subsequences) inside sequences.
  • Random DNA Generator: Create random DNA sequences of desired length.

Installation

You can install PyBioQuanta via pip once it's uploaded:

pip install PyBioQuanta

Usage

1. FASTA Reader

from PyBioQuanta import read_fasta

sequences = read_fasta("example.fasta")
print(sequences)

2. Reverse Complement

from PyBioQuanta import reverse_complement

seq = "ATCG"
rc = reverse_complement(seq)
print(rc)

3. DNA Translator

from PyBioQuanta import translate_dna

dna_seq = "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
protein = translate_dna(dna_seq)
print(protein)

4. GC Content Calculator

from PyBioQuanta import gc_content

seq = "ATGCGC"
gc_percentage = gc_content(seq)
print(f"GC Content: {gc_percentage:.2f}%")

5. Motif Finder

from PyBioQuanta import find_motif

seq = "ATGCGCGTAGCGC"
motif = "GCG"
positions = find_motif(seq, motif)
print(positions)

6. Random DNA Generator

from PyBioQuanta import generate_random_dna

random_seq = generate_random_dna(50)
print(random_seq)

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

PyBioQuanta-0.1.1.tar.gz (3.8 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

PyBioQuanta-0.1.1-py3-none-any.whl (5.1 kB view details)

Uploaded Python 3

File details

Details for the file PyBioQuanta-0.1.1.tar.gz.

File metadata

  • Download URL: PyBioQuanta-0.1.1.tar.gz
  • Upload date:
  • Size: 3.8 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.10.5

File hashes

Hashes for PyBioQuanta-0.1.1.tar.gz
Algorithm Hash digest
SHA256 c13a3bf3e3889eb695f8d4ff6868b3903e9a82150e1b773fd0eef2471e1f7f77
MD5 8cadc66fe658574e36a099714dc07556
BLAKE2b-256 d9c2852d38b7752ba2c6fc3ac998b3a79830ab370fd03f661fb97f07b5f0305d

See more details on using hashes here.

File details

Details for the file PyBioQuanta-0.1.1-py3-none-any.whl.

File metadata

  • Download URL: PyBioQuanta-0.1.1-py3-none-any.whl
  • Upload date:
  • Size: 5.1 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.10.5

File hashes

Hashes for PyBioQuanta-0.1.1-py3-none-any.whl
Algorithm Hash digest
SHA256 9aceea16dad859394942f3955988003cfeafbf17c1adf038c34e23c0c3596a3a
MD5 bb1435c73a2c386906e5dec169a6be33
BLAKE2b-256 6c6af9f411c22a793922d1f978fe6853fa8e454d85d492db7986e69f7682435f

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.1.1 This release

2 files

0.1.0

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page