Skip to main content

A Python interface to IGV-style alignment visualization

Project description

PyIGV

Python alignment viewer library based on the Integrative Genomics Viewer (IGV) style for visualizing DNA/RNA sequence alignments.

PyPI - Python Version License

Overview

PyIGV provides a simple, intuitive way to visualize pairwise sequence alignments in Python. It displays alignments in an IGV-like format, with color-coded mismatches, insertions, and deletions.

Installation

pip install pyigv

Features

  • Color-coded visualization: Mismatches are highlighted with base-specific colors (A=green, T=red, G=gold, C=blue)
  • Automatic alignment: Uses Biopython's PairwiseAligner when alignment strings aren't provided
  • Gap handling: Automatically detects and visualizes insertions and deletions
  • Mutation counting: Tracks the number of insertions, deletions, and substitutions
  • PDF export: Save alignment visualizations to PDF files
  • Flexible display: Option to show full alignments or truncated views (hiding insertions)

Quick Start

from pyigv import Alignment, plot_alignments

# Define your sequences
target = "AAATAAA"
query = "AAAGAAA"

# Option 1: Auto-alignment (recommended)
aln = Alignment(target, query)

# Option 2: Provide pre-aligned sequences with gaps
alignment = ["AAATAAA", "AAAGAAA"]
aln = Alignment(target, query, alignment)

# Print alignment information
print(aln)
print(f"Mutations: {aln.mutation_ct}")
print(f"Insertions: {aln.insertion_ct}")
print(f"Deletions: {aln.deletion_ct}")

# Visualize alignments
alignments = [aln]
plot_alignments(alignments, title="Sample Alignment")

Usage Examples

Auto-Alignment (No Pre-alignment Required)

from pyigv import Alignment

# PyIGV automatically aligns sequences using Biopython
target = "AAACCCGGG"
query = "AAATTTGGG"

aln = Alignment(target, query)
print(f"Mutations: {aln.mutation_ct}")
print(f"Insertions: {aln.insertion_ct}")
print(f"Deletions: {aln.deletion_ct}")

Basic Alignment with Manual Alignment Strings

from pyigv import Alignment

# Perfect match
target = "AAAA"
query = "AAAA"
alignment = ["AAAA", "AAAA"]
aln = Alignment(target, query, alignment)
print(f"Mutations: {aln.mutation_ct}")  # Output: 0

Alignment with Mismatch

# Single mismatch at position 3
target = "AAAA"
query = "AAAT"
alignment = ["AAAA", "AAAT"]
aln = Alignment(target, query, alignment)
print(f"Mutations: {aln.mutation_ct}")  # Output: 1

Alignment with Insertion

# Insertion in query
target = "AAAA"
query = "AAAAA"
alignment = ["AAAA-", "AAAAA"]  # '-' indicates gap in target
aln = Alignment(target, query, alignment)
print(f"Insertions: {aln.insertion_ct}")  # Output: 1

Alignment with Deletion

# Deletion in query
target = "AAAAA"
query = "AAAA"
alignment = ["AAAAA", "AAAA-"]  # '-' indicates gap in query
aln = Alignment(target, query, alignment)
print(f"Deletions: {aln.deletion_ct}")  # Output: 1

Plotting Multiple Alignments

from pyigv import Alignment, plot_alignments
import matplotlib.pyplot as plt

target = "AAACCCGGGTTTATATATAT"

# Create multiple query sequences
queries = [
    "AAACCCGGGTTTATATATAT",  # Perfect match
    "AAAGCCGGGTTTATATATAT",  # One mismatch
    "AAACCCGGGTTTTATATAT",   # One deletion
    "AAACCCGGGTTTATATATATAT", # One insertion
    "AAATTTGGGAAACCCCCCCC",  # Multiple changes
]

# Auto-align all queries against the target
alignments = [Alignment(target, query) for query in queries]

# Plot and display
plot_alignments(alignments, title="Multiple Query Comparison")
plt.show()

Saving to PDF

from pyigv import plot_alignments
from matplotlib.backends.backend_pdf import PdfPages

# Create your alignments
target = "AAATAAA"
queries = ["AAAGAAA", "AAACAAA", "AAAAAAA"]
alignments = [Alignment(target, q) for q in queries]

# Save to PDF
with PdfPages("alignment_output.pdf") as pdf:
    plot_alignments(alignments, title="My Alignments", pdf=pdf)

Truncated View (Default)

By default, PyIGV uses truncated view to focus on the reference sequence. In truncated mode, insertions are displayed as purple boxes with numbers indicating insertion length:

plot_alignments(
    alignments,
    title="Truncated View"
    # truncate=True is the default
)

To show full alignments including all insertions, set truncate=False:

plot_alignments(
    alignments,
    title="Full View",
    truncate=False  # Show all insertions in full
)

API Reference

Alignment Class

Constructor

Alignment(target: str, query: str, alignment: Optional[Sequence[str]] = None)

Parameters:

  • target: The target (reference) sequence
  • query: The query sequence
  • alignment (optional): A list/tuple of two strings representing the aligned sequences with gaps marked as '-'. If not provided, uses Biopython's PairwiseAligner to automatically align the sequences.

Attributes

  • target: Target sequence (without gaps)
  • query: Query sequence (without gaps)
  • target_alignment: Aligned target sequence with gaps
  • query_alignment: Aligned query sequence with gaps
  • symbols: Processed alignment symbols
  • edits: Edit operations (I=insertion, D=deletion, M=mismatch, space=match)
  • insertion_ct: Number of insertions
  • deletion_ct: Number of deletions
  • mutation_ct: Number of mismatches/substitutions

Methods

  • get_color_row(truncate: bool = False): Get color codes for visualization
  • get_symbols(truncate: bool = False): Get alignment symbols
  • get_insertion_indices(): Get positions and lengths of insertions
  • __lt__(other): Compare alignments by number of edits (for sorting)

plot_alignments Function

plot_alignments(
    alignments,
    title: Optional[str] = None,
    pdf: Optional[str] = None,
    truncate: bool = True,
    return_fig: bool = False
) -> Optional[plt.Figure]

Parameters:

  • alignments: List of Alignment objects to visualize
  • title (optional): Title for the plot. If not provided, defaults to "Alignments"
  • pdf (optional): PdfPages object for saving to PDF
  • truncate (optional): If True (default), removes insertions from display and shows them as numbered purple boxes. Set to False to show full alignments.
  • return_fig (optional): If True, returns the Figure object instead of None

Returns:

  • matplotlib Figure object if return_fig=True, otherwise None

Color Scheme

  • Green (A): Adenine mismatches or insertions
  • Red (T): Thymine mismatches or insertions
  • Gold (G): Guanine mismatches or insertions
  • Blue (C): Cytosine mismatches or insertions
  • Gray: Matches
  • White: Deletions
  • Purple boxes (truncate mode): Insertion indicators with length

Example Output

Here's what a typical PyIGV visualization looks like:

from pyigv import Alignment, plot_alignments

target = "AAACCCGGGTTTATATATAT"
queries = [
    "AAACCCGGGTTTATATATAT",  # Perfect match
    "AAAGCCGGGTTTATATATAT",  # One mismatch
    "AAACCCGGGTTTTATATAT",   # One deletion
    "AAACCCGGGTTTATATATATAT", # One insertion
    "AAATTTGGGAAACCCCCCCC",  # Multiple changes
]

alignments = [Alignment(target, q) for q in queries]
plot_alignments(alignments, title="Example Alignment Visualization")

Normal View

Example Alignment Output

The output shows:

  • The reference sequence in the top row
  • Each query alignment in subsequent rows
  • Color-coded differences (mismatches, insertions, deletions)
  • Sorted by alignment quality (best matches first)

Truncated View (Default)

By default, sequences with insertions are shown in truncated view with insertion counts as purple boxes:

Example Truncated Output

# Default behavior (truncate=True)
plot_alignments(alignments, title="Example Truncated View")

Development

Running Tests

# Install development dependencies
pip install -e ".[dev]"

# Run tests
pytest tests/

# Run specific test
pytest tests/test_alignment.py::test_plot_alignments_with_multiple_queries -v -s

Code Quality

# Format code with Black
black src/ tests/

# Lint code
flake8 src/ tests/

Requirements

  • Python 3.7+
  • numpy >= 1.19.0
  • matplotlib >= 3.3.0
  • biopython >= 1.86

License

MIT License - see LICENSE file for details

Contributing

Contributions are welcome! Please feel free to submit a Pull Request.

Citation

If you use PyIGV in your research, please cite:

PyIGV: Python alignment viewer library
https://github.com/regev-lab/PyIGV

Support

For issues, questions, or contributions, please visit:

Changelog

v0.1.0

  • Initial release
  • Color-coded alignment visualization
  • Automatic alignment using Biopython
  • PDF export support
  • Truncated view mode for insertions
  • Comprehensive test suite

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pyigv-0.1.4.tar.gz (10.0 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

pyigv-0.1.4-py3-none-any.whl (8.1 kB view details)

Uploaded Python 3

File details

Details for the file pyigv-0.1.4.tar.gz.

File metadata

  • Download URL: pyigv-0.1.4.tar.gz
  • Upload date:
  • Size: 10.0 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.4

File hashes

Hashes for pyigv-0.1.4.tar.gz
Algorithm Hash digest
SHA256 c267b7f9b910503fcba734517f6ccf9c340bda9f1f08b7a120738d13f176289b
MD5 3dab27c8adfe76a163c63b9d20a58f16
BLAKE2b-256 a6677aa1fe4f71bed23cde69bf4b3504e3e156dff84665cea1c135a4c6d100c3

See more details on using hashes here.

File details

Details for the file pyigv-0.1.4-py3-none-any.whl.

File metadata

  • Download URL: pyigv-0.1.4-py3-none-any.whl
  • Upload date:
  • Size: 8.1 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.4

File hashes

Hashes for pyigv-0.1.4-py3-none-any.whl
Algorithm Hash digest
SHA256 8071e1cb073548ca5c7d0476fd16affada30a8fae1bf2d716acc9a65234ec82c
MD5 8f9c36bd21142673c9598d4bba6693b9
BLAKE2b-256 5679f5a2bf287a85152f6dc81771c99522858b3abcbcaabeee23e35cbc506587

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page